ID: 1088733309

View in Genome Browser
Species Human (GRCh38)
Location 11:112703294-112703316
Sequence ATGTGTTGAGGGAGGCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088733300_1088733309 8 Left 1088733300 11:112703263-112703285 CCACTTGTGGAGGGAAGGGCCTG No data
Right 1088733309 11:112703294-112703316 ATGTGTTGAGGGAGGCAGGTTGG No data
1088733298_1088733309 10 Left 1088733298 11:112703261-112703283 CCCCACTTGTGGAGGGAAGGGCC No data
Right 1088733309 11:112703294-112703316 ATGTGTTGAGGGAGGCAGGTTGG No data
1088733299_1088733309 9 Left 1088733299 11:112703262-112703284 CCCACTTGTGGAGGGAAGGGCCT No data
Right 1088733309 11:112703294-112703316 ATGTGTTGAGGGAGGCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088733309 Original CRISPR ATGTGTTGAGGGAGGCAGGT TGG Intergenic
No off target data available for this crispr