ID: 1088735935

View in Genome Browser
Species Human (GRCh38)
Location 11:112727734-112727756
Sequence CCCACCTCCAAAGAAGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088735935_1088735943 -10 Left 1088735935 11:112727734-112727756 CCAACCCCTTCTTTGGAGGTGGG No data
Right 1088735943 11:112727747-112727769 TGGAGGTGGGGGTAAGGATATGG No data
1088735935_1088735947 6 Left 1088735935 11:112727734-112727756 CCAACCCCTTCTTTGGAGGTGGG No data
Right 1088735947 11:112727763-112727785 GATATGGCTGTGGGGAAGAGTGG No data
1088735935_1088735945 -3 Left 1088735935 11:112727734-112727756 CCAACCCCTTCTTTGGAGGTGGG No data
Right 1088735945 11:112727754-112727776 GGGGGTAAGGATATGGCTGTGGG No data
1088735935_1088735944 -4 Left 1088735935 11:112727734-112727756 CCAACCCCTTCTTTGGAGGTGGG No data
Right 1088735944 11:112727753-112727775 TGGGGGTAAGGATATGGCTGTGG No data
1088735935_1088735946 -2 Left 1088735935 11:112727734-112727756 CCAACCCCTTCTTTGGAGGTGGG No data
Right 1088735946 11:112727755-112727777 GGGGTAAGGATATGGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088735935 Original CRISPR CCCACCTCCAAAGAAGGGGT TGG (reversed) Intergenic