ID: 1088735939

View in Genome Browser
Species Human (GRCh38)
Location 11:112727738-112727760
Sequence TACCCCCACCTCCAAAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088735939_1088735944 -8 Left 1088735939 11:112727738-112727760 CCCCTTCTTTGGAGGTGGGGGTA No data
Right 1088735944 11:112727753-112727775 TGGGGGTAAGGATATGGCTGTGG No data
1088735939_1088735948 29 Left 1088735939 11:112727738-112727760 CCCCTTCTTTGGAGGTGGGGGTA No data
Right 1088735948 11:112727790-112727812 GCTTCTCTGTTGTCTGCTAGAGG No data
1088735939_1088735946 -6 Left 1088735939 11:112727738-112727760 CCCCTTCTTTGGAGGTGGGGGTA No data
Right 1088735946 11:112727755-112727777 GGGGTAAGGATATGGCTGTGGGG No data
1088735939_1088735945 -7 Left 1088735939 11:112727738-112727760 CCCCTTCTTTGGAGGTGGGGGTA No data
Right 1088735945 11:112727754-112727776 GGGGGTAAGGATATGGCTGTGGG No data
1088735939_1088735947 2 Left 1088735939 11:112727738-112727760 CCCCTTCTTTGGAGGTGGGGGTA No data
Right 1088735947 11:112727763-112727785 GATATGGCTGTGGGGAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088735939 Original CRISPR TACCCCCACCTCCAAAGAAG GGG (reversed) Intergenic
No off target data available for this crispr