ID: 1088735940

View in Genome Browser
Species Human (GRCh38)
Location 11:112727739-112727761
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088735940_1088735945 -8 Left 1088735940 11:112727739-112727761 CCCTTCTTTGGAGGTGGGGGTAA No data
Right 1088735945 11:112727754-112727776 GGGGGTAAGGATATGGCTGTGGG No data
1088735940_1088735944 -9 Left 1088735940 11:112727739-112727761 CCCTTCTTTGGAGGTGGGGGTAA No data
Right 1088735944 11:112727753-112727775 TGGGGGTAAGGATATGGCTGTGG No data
1088735940_1088735946 -7 Left 1088735940 11:112727739-112727761 CCCTTCTTTGGAGGTGGGGGTAA No data
Right 1088735946 11:112727755-112727777 GGGGTAAGGATATGGCTGTGGGG No data
1088735940_1088735947 1 Left 1088735940 11:112727739-112727761 CCCTTCTTTGGAGGTGGGGGTAA No data
Right 1088735947 11:112727763-112727785 GATATGGCTGTGGGGAAGAGTGG No data
1088735940_1088735948 28 Left 1088735940 11:112727739-112727761 CCCTTCTTTGGAGGTGGGGGTAA No data
Right 1088735948 11:112727790-112727812 GCTTCTCTGTTGTCTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088735940 Original CRISPR TTACCCCCACCTCCAAAGAA GGG (reversed) Intergenic