ID: 1088735941

View in Genome Browser
Species Human (GRCh38)
Location 11:112727740-112727762
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088735941_1088735944 -10 Left 1088735941 11:112727740-112727762 CCTTCTTTGGAGGTGGGGGTAAG No data
Right 1088735944 11:112727753-112727775 TGGGGGTAAGGATATGGCTGTGG No data
1088735941_1088735947 0 Left 1088735941 11:112727740-112727762 CCTTCTTTGGAGGTGGGGGTAAG No data
Right 1088735947 11:112727763-112727785 GATATGGCTGTGGGGAAGAGTGG No data
1088735941_1088735948 27 Left 1088735941 11:112727740-112727762 CCTTCTTTGGAGGTGGGGGTAAG No data
Right 1088735948 11:112727790-112727812 GCTTCTCTGTTGTCTGCTAGAGG No data
1088735941_1088735945 -9 Left 1088735941 11:112727740-112727762 CCTTCTTTGGAGGTGGGGGTAAG No data
Right 1088735945 11:112727754-112727776 GGGGGTAAGGATATGGCTGTGGG No data
1088735941_1088735946 -8 Left 1088735941 11:112727740-112727762 CCTTCTTTGGAGGTGGGGGTAAG No data
Right 1088735946 11:112727755-112727777 GGGGTAAGGATATGGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088735941 Original CRISPR CTTACCCCCACCTCCAAAGA AGG (reversed) Intergenic