ID: 1088735946

View in Genome Browser
Species Human (GRCh38)
Location 11:112727755-112727777
Sequence GGGGTAAGGATATGGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088735929_1088735946 25 Left 1088735929 11:112727707-112727729 CCTGGTGATTCAGAGGCTCTCTG No data
Right 1088735946 11:112727755-112727777 GGGGTAAGGATATGGCTGTGGGG No data
1088735933_1088735946 -1 Left 1088735933 11:112727733-112727755 CCCAACCCCTTCTTTGGAGGTGG No data
Right 1088735946 11:112727755-112727777 GGGGTAAGGATATGGCTGTGGGG No data
1088735940_1088735946 -7 Left 1088735940 11:112727739-112727761 CCCTTCTTTGGAGGTGGGGGTAA No data
Right 1088735946 11:112727755-112727777 GGGGTAAGGATATGGCTGTGGGG No data
1088735931_1088735946 2 Left 1088735931 11:112727730-112727752 CCTCCCAACCCCTTCTTTGGAGG No data
Right 1088735946 11:112727755-112727777 GGGGTAAGGATATGGCTGTGGGG No data
1088735935_1088735946 -2 Left 1088735935 11:112727734-112727756 CCAACCCCTTCTTTGGAGGTGGG No data
Right 1088735946 11:112727755-112727777 GGGGTAAGGATATGGCTGTGGGG No data
1088735941_1088735946 -8 Left 1088735941 11:112727740-112727762 CCTTCTTTGGAGGTGGGGGTAAG No data
Right 1088735946 11:112727755-112727777 GGGGTAAGGATATGGCTGTGGGG No data
1088735939_1088735946 -6 Left 1088735939 11:112727738-112727760 CCCCTTCTTTGGAGGTGGGGGTA No data
Right 1088735946 11:112727755-112727777 GGGGTAAGGATATGGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088735946 Original CRISPR GGGGTAAGGATATGGCTGTG GGG Intergenic