ID: 1088735948

View in Genome Browser
Species Human (GRCh38)
Location 11:112727790-112727812
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088735939_1088735948 29 Left 1088735939 11:112727738-112727760 CCCCTTCTTTGGAGGTGGGGGTA No data
Right 1088735948 11:112727790-112727812 GCTTCTCTGTTGTCTGCTAGAGG No data
1088735941_1088735948 27 Left 1088735941 11:112727740-112727762 CCTTCTTTGGAGGTGGGGGTAAG No data
Right 1088735948 11:112727790-112727812 GCTTCTCTGTTGTCTGCTAGAGG No data
1088735940_1088735948 28 Left 1088735940 11:112727739-112727761 CCCTTCTTTGGAGGTGGGGGTAA No data
Right 1088735948 11:112727790-112727812 GCTTCTCTGTTGTCTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088735948 Original CRISPR GCTTCTCTGTTGTCTGCTAG AGG Intergenic