ID: 1088737526

View in Genome Browser
Species Human (GRCh38)
Location 11:112740098-112740120
Sequence GGCAGCATTGGCCTTCGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088737526_1088737530 -6 Left 1088737526 11:112740098-112740120 CCATCTCGAAGGCCAATGCTGCC No data
Right 1088737530 11:112740115-112740137 GCTGCCTGCTCTGGAGATGGAGG No data
1088737526_1088737534 11 Left 1088737526 11:112740098-112740120 CCATCTCGAAGGCCAATGCTGCC No data
Right 1088737534 11:112740132-112740154 TGGAGGGAGGCCGCACAGCATGG No data
1088737526_1088737529 -9 Left 1088737526 11:112740098-112740120 CCATCTCGAAGGCCAATGCTGCC No data
Right 1088737529 11:112740112-112740134 AATGCTGCCTGCTCTGGAGATGG No data
1088737526_1088737531 -5 Left 1088737526 11:112740098-112740120 CCATCTCGAAGGCCAATGCTGCC No data
Right 1088737531 11:112740116-112740138 CTGCCTGCTCTGGAGATGGAGGG No data
1088737526_1088737539 23 Left 1088737526 11:112740098-112740120 CCATCTCGAAGGCCAATGCTGCC No data
Right 1088737539 11:112740144-112740166 GCACAGCATGGGGGAATCGCTGG No data
1088737526_1088737536 13 Left 1088737526 11:112740098-112740120 CCATCTCGAAGGCCAATGCTGCC No data
Right 1088737536 11:112740134-112740156 GAGGGAGGCCGCACAGCATGGGG No data
1088737526_1088737533 -2 Left 1088737526 11:112740098-112740120 CCATCTCGAAGGCCAATGCTGCC No data
Right 1088737533 11:112740119-112740141 CCTGCTCTGGAGATGGAGGGAGG No data
1088737526_1088737537 14 Left 1088737526 11:112740098-112740120 CCATCTCGAAGGCCAATGCTGCC No data
Right 1088737537 11:112740135-112740157 AGGGAGGCCGCACAGCATGGGGG No data
1088737526_1088737540 24 Left 1088737526 11:112740098-112740120 CCATCTCGAAGGCCAATGCTGCC No data
Right 1088737540 11:112740145-112740167 CACAGCATGGGGGAATCGCTGGG No data
1088737526_1088737535 12 Left 1088737526 11:112740098-112740120 CCATCTCGAAGGCCAATGCTGCC No data
Right 1088737535 11:112740133-112740155 GGAGGGAGGCCGCACAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088737526 Original CRISPR GGCAGCATTGGCCTTCGAGA TGG (reversed) Intergenic
No off target data available for this crispr