ID: 1088737533

View in Genome Browser
Species Human (GRCh38)
Location 11:112740119-112740141
Sequence CCTGCTCTGGAGATGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088737523_1088737533 26 Left 1088737523 11:112740070-112740092 CCGCACACTGGGCTGCAAGAACA No data
Right 1088737533 11:112740119-112740141 CCTGCTCTGGAGATGGAGGGAGG No data
1088737526_1088737533 -2 Left 1088737526 11:112740098-112740120 CCATCTCGAAGGCCAATGCTGCC No data
Right 1088737533 11:112740119-112740141 CCTGCTCTGGAGATGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088737533 Original CRISPR CCTGCTCTGGAGATGGAGGG AGG Intergenic
No off target data available for this crispr