ID: 1088738873

View in Genome Browser
Species Human (GRCh38)
Location 11:112750752-112750774
Sequence GGAGGCGTCAATCTCATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088738873_1088738881 16 Left 1088738873 11:112750752-112750774 CCAGAGATGAGATTGACGCCTCC No data
Right 1088738881 11:112750791-112750813 GCTGGACTTACCAACATGCTTGG No data
1088738873_1088738874 -6 Left 1088738873 11:112750752-112750774 CCAGAGATGAGATTGACGCCTCC No data
Right 1088738874 11:112750769-112750791 GCCTCCTCTCCCCTTAGACATGG No data
1088738873_1088738877 -2 Left 1088738873 11:112750752-112750774 CCAGAGATGAGATTGACGCCTCC No data
Right 1088738877 11:112750773-112750795 CCTCTCCCCTTAGACATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088738873 Original CRISPR GGAGGCGTCAATCTCATCTC TGG (reversed) Intergenic
No off target data available for this crispr