ID: 1088743164

View in Genome Browser
Species Human (GRCh38)
Location 11:112783487-112783509
Sequence CTGTGTTACAGTGAGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088743163_1088743164 -9 Left 1088743163 11:112783473-112783495 CCTAAAAGATCTCACTGTGTTAC No data
Right 1088743164 11:112783487-112783509 CTGTGTTACAGTGAGTTGTCAGG No data
1088743159_1088743164 18 Left 1088743159 11:112783446-112783468 CCTCCAGGTGCAAGAAGGTCCTA No data
Right 1088743164 11:112783487-112783509 CTGTGTTACAGTGAGTTGTCAGG No data
1088743158_1088743164 19 Left 1088743158 11:112783445-112783467 CCCTCCAGGTGCAAGAAGGTCCT No data
Right 1088743164 11:112783487-112783509 CTGTGTTACAGTGAGTTGTCAGG No data
1088743160_1088743164 15 Left 1088743160 11:112783449-112783471 CCAGGTGCAAGAAGGTCCTACCT No data
Right 1088743164 11:112783487-112783509 CTGTGTTACAGTGAGTTGTCAGG No data
1088743161_1088743164 -1 Left 1088743161 11:112783465-112783487 CCTACCTTCCTAAAAGATCTCAC No data
Right 1088743164 11:112783487-112783509 CTGTGTTACAGTGAGTTGTCAGG No data
1088743162_1088743164 -5 Left 1088743162 11:112783469-112783491 CCTTCCTAAAAGATCTCACTGTG No data
Right 1088743164 11:112783487-112783509 CTGTGTTACAGTGAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088743164 Original CRISPR CTGTGTTACAGTGAGTTGTC AGG Intergenic
No off target data available for this crispr