ID: 1088743799

View in Genome Browser
Species Human (GRCh38)
Location 11:112787700-112787722
Sequence CTGTGAATTTGGAGCTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088743799_1088743803 24 Left 1088743799 11:112787700-112787722 CCATCATAGCTCCAAATTCACAG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1088743803 11:112787747-112787769 CTTTTTTTTTCAGATTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088743799 Original CRISPR CTGTGAATTTGGAGCTATGA TGG (reversed) Intergenic
900630997 1:3635164-3635186 CTGGCAGTTGGGAGCTATGATGG - Exonic
907586205 1:55620345-55620367 CTGGGCCTTTGGACCTATGATGG - Intergenic
908403921 1:63795218-63795240 TTGTGGCTTTGGAGCTATGCCGG + Intronic
909435624 1:75638259-75638281 GTGTGATTTTGGAGCAGTGATGG - Intergenic
909545580 1:76842915-76842937 CTGTGAATTTTGATATCTGAGGG - Intergenic
911298519 1:96146915-96146937 CTGTGCGTTGGGAGATATGATGG + Intergenic
913043406 1:115052277-115052299 CAGTGAATTTGCAGTTATCAGGG - Intronic
914459676 1:147871865-147871887 CTGTGATTTTGGTTCTCTGATGG - Intergenic
914972200 1:152317430-152317452 ATGTGGATTTGGAAATATGAAGG - Intronic
916295798 1:163218099-163218121 CTGGTAATTTGGAGCTATGCAGG + Intronic
917297165 1:173532551-173532573 ATGTGACTGTGGAGCTATGGAGG + Intronic
918526618 1:185471752-185471774 ATATGAATTTGGAGCTCGGAGGG + Intergenic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1068252676 10:54464076-54464098 CTGTGCAGGTGAAGCTATGAAGG - Intronic
1071911934 10:90246426-90246448 CTCTGAATCTGGAGGTAAGAAGG + Intergenic
1074752551 10:116600665-116600687 CTCTGAATTTGGAGTTGGGAAGG - Intronic
1075960891 10:126567036-126567058 CTGTGAACATGGAGCTCAGAGGG + Intronic
1080992646 11:37557981-37558003 CTGAGATTTTGGAGTGATGAAGG - Intergenic
1081049752 11:38323976-38323998 CTATGGTTTTGGATCTATGAAGG - Intergenic
1082108503 11:48245752-48245774 CTGAGAACCTGGAGCTCTGAAGG + Exonic
1082678118 11:56134301-56134323 ATGAGAATTTTGAGCTAGGAAGG - Intergenic
1083049104 11:59761277-59761299 CTGAGACTTTGGAGATATGTAGG - Intronic
1087493884 11:98864253-98864275 CTGGGACTTTGGGCCTATGATGG + Intergenic
1087589834 11:100173312-100173334 CCTTGAATTTGGAGGTAGGAAGG - Intronic
1088546248 11:110962308-110962330 CTGTTATTTTAGGGCTATGAAGG + Intergenic
1088743799 11:112787700-112787722 CTGTGAATTTGGAGCTATGATGG - Intergenic
1093385826 12:18552029-18552051 CTGTGAACTTTGAGCTGTGAGGG + Intronic
1093422562 12:18991839-18991861 TTCTGAATCTGGAGCTCTGAGGG - Intergenic
1095190457 12:39251791-39251813 CTGTTGATTTGGAGGTATGAGGG - Intergenic
1098051922 12:66463158-66463180 CTGTGAAATTTTAACTATGAAGG - Intronic
1098614193 12:72502856-72502878 ATGTGAATATGGAGAAATGAGGG + Intronic
1098854784 12:75639926-75639948 GTGTGAGTTTGGTGGTATGAAGG + Intergenic
1107637362 13:42406188-42406210 CAGAGAATTTGGAGCTTTAAGGG + Intergenic
1108837331 13:54567951-54567973 CTGTAATTTAGGAGCCATGAAGG - Intergenic
1109641652 13:65199524-65199546 CTGTGAAGTAAGAGCTATCATGG - Intergenic
1110206094 13:72915560-72915582 CTCTGAATTTAGAACTATTAAGG + Intronic
1112534143 13:100233515-100233537 CATTGAATTTGGAGCTATATAGG + Intronic
1114960817 14:27886773-27886795 ATTTTAATTTAGAGCTATGAGGG + Intergenic
1115521032 14:34233300-34233322 CTGTAAAGTTGGAGCCAAGAAGG + Intronic
1115574412 14:34696516-34696538 CACTGAATTTGGCCCTATGAAGG - Intergenic
1116233462 14:42247934-42247956 ATGTGTATTTGGATCTGTGAAGG - Intergenic
1116628664 14:47300316-47300338 ATGTGAATTTTGAGCTAGTAAGG + Intronic
1117847233 14:59924136-59924158 TGGTGAATTTGGAGCTTTGAAGG + Intronic
1117926554 14:60785579-60785601 CAGAGAATGTGGGGCTATGAAGG - Intronic
1118453889 14:65928283-65928305 CTTTGTATTTGGAGCTAAGTAGG - Intergenic
1119205644 14:72791627-72791649 TTGTGATTTTGAAGCTGTGATGG - Intronic
1122300316 14:100727535-100727557 CTGGGAATTGGGGGCTAAGACGG - Intronic
1123854407 15:24393319-24393341 CTGTGAACTGGGAGCTGTGTGGG - Intergenic
1123870425 15:24566503-24566525 CTGTGAACGGGGAGCTATGTGGG - Intergenic
1124866937 15:33501380-33501402 TTTAGCATTTGGAGCTATGAGGG + Intronic
1125471612 15:40009855-40009877 CTTTCAATTTAGAGCAATGAAGG - Intronic
1126383616 15:48072215-48072237 CTGGGAACTTTGAGGTATGATGG - Intergenic
1127225443 15:56922999-56923021 CTATGTATTTGCAGCTATTAAGG + Intronic
1129008411 15:72394590-72394612 TTTTGAATTTGGGGCTATTATGG + Intergenic
1129233652 15:74210663-74210685 CTGTGAGTAAGGAGCTGTGAAGG + Intronic
1129906915 15:79194949-79194971 ATGTGAGTTTGGAGAGATGATGG - Intergenic
1131342861 15:91619145-91619167 CTGAGAGTTTGGACGTATGAAGG + Intergenic
1131696099 15:94879743-94879765 CTGACAATTTTGAGTTATGATGG - Intergenic
1132026648 15:98409255-98409277 CTGTGAATTTAGTGGAATGAGGG + Intergenic
1134461529 16:14433884-14433906 CTTTGATTTTGGAGCTGGGATGG - Intergenic
1144391785 17:14800359-14800381 CTGTGAATAGGGAGCTGTGATGG + Intergenic
1151435404 17:74092738-74092760 ATGTGAAGTCAGAGCTATGACGG - Intergenic
1154361902 18:13669969-13669991 CTGTGAAGTAGGAGATATGGAGG - Intronic
1156512613 18:37653830-37653852 CTAGGGATTTGGAGCTCTGATGG + Intergenic
1157846616 18:51009401-51009423 CTGTGAATTAAGGGCTCTGAGGG + Intronic
1158645253 18:59240360-59240382 CTGTGTACTTGGGACTATGATGG - Intergenic
1161212189 19:3072896-3072918 CTGTAAGGTTGGAGCTATGTGGG - Intergenic
1162130070 19:8521040-8521062 CTGTGAGGTAGGAGCTGTGAAGG - Exonic
1162256487 19:9494333-9494355 TCGTGAATTTGGAGCTGAGATGG - Intronic
1163882249 19:19935347-19935369 CTCTGAATTTGTAGTGATGAGGG - Exonic
1164388278 19:27794944-27794966 ATGTGAATTTTGAGACATGAGGG + Intergenic
1164892814 19:31839564-31839586 ATGTGAAGTGGGAGCTATGGGGG - Intergenic
1166283271 19:41809123-41809145 CTGTGAATTTGGCCCAATTAAGG + Intronic
1168225947 19:54995313-54995335 CTGTTTATTTGCAGCTATGTGGG - Intronic
927443431 2:23136646-23136668 CTGAGAATTAGTAGCCATGATGG - Intergenic
929259661 2:39851539-39851561 CTGCACATTTGGAGCCATGAGGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930449975 2:51523398-51523420 CTGTGATTTGGGTGCTGTGATGG + Intergenic
933395665 2:81727861-81727883 CATTGAAGTTGGAGCTATTAGGG + Intergenic
933683940 2:85128102-85128124 CTATGAATTTTGTGCTTTGAAGG - Intergenic
937712559 2:124995145-124995167 CTGTGCTTTTGGAGAGATGATGG - Intergenic
940603565 2:155891419-155891441 CTATGATTTAGGAGCTATAATGG - Intergenic
941109164 2:161398672-161398694 CTATAAATTTGGAGATCTGACGG + Intronic
941371502 2:164671139-164671161 CTGAGAATTGGGAGTGATGAAGG - Intronic
941540706 2:166780579-166780601 CTGTCACTCAGGAGCTATGATGG - Intergenic
942258531 2:174133269-174133291 AGGAGAATTTGGACCTATGATGG + Intronic
942996202 2:182263570-182263592 CTGTGAATTCAGAGCTAAGAGGG - Intronic
947328281 2:229001291-229001313 CTGTGAGTTTGTGGCTGTGAAGG + Intronic
947935431 2:233999645-233999667 CTGTGAATTTGGGAGTAGGACGG - Intronic
1172254474 20:33505165-33505187 TTTTGGATTTGGAGCTGTGAGGG + Intronic
1173945843 20:46950394-46950416 CTGTGAGTTTGGAGGTCTCATGG + Intronic
1174090593 20:48044055-48044077 CTGTGACTTTGGGGCTGAGAAGG + Intergenic
1174189308 20:48728926-48728948 CTGTGAATTTTGAGCATTTAAGG - Intronic
1176957303 21:15120689-15120711 CTGTGAATTTTGTCTTATGATGG - Intergenic
1177106243 21:16958890-16958912 CAGTGACTTTGGAGCTAGGAAGG + Intergenic
1177534777 21:22410013-22410035 ATGTCAGTTTGGTGCTATGAAGG + Intergenic
1179798431 21:43799112-43799134 CTGGGCATTTGGGGCTTTGATGG - Intronic
1180605300 22:17054563-17054585 CTGGAAATTTGGAGCTAGCAGGG + Intergenic
1182180336 22:28340363-28340385 TAGTGAATTTGGAGGCATGAAGG - Intronic
1184303855 22:43580989-43581011 CTGAGAATCTGGCCCTATGACGG + Intronic
1184391956 22:44207802-44207824 CTGTGAATTGGGAGCTGAGAAGG - Exonic
949185230 3:1183251-1183273 CTGTGAATCCGAAGCTATCATGG + Intronic
949523564 3:4879969-4879991 CTGTGAAGTTGCTGGTATGAGGG - Intronic
950645657 3:14375058-14375080 CTGAGAATTAGGAGCTAGAATGG - Intergenic
951457501 3:22908960-22908982 CTGTGATTTTGGAAGTGTGATGG - Intergenic
954758932 3:52860353-52860375 CTGTCAATGAGGAGGTATGAAGG + Intronic
955655475 3:61240564-61240586 CTGTAAATTTTGAGGTATTATGG + Intronic
957288384 3:78246393-78246415 CTGTGCATTTGCAGCTAGGGAGG + Intergenic
961984090 3:131114004-131114026 CTGGGAATTTGGAGTGAGGAGGG + Intronic
964907943 3:161741595-161741617 CTTTGAATTTGGAAAAATGAAGG - Intergenic
965781964 3:172295552-172295574 CTGTAAAATTGGAGTTGTGAAGG + Intronic
966666609 3:182478745-182478767 CTTTGTATTTGAAGCTCTGATGG - Intergenic
967233624 3:187364719-187364741 CTGTCCATTTGGAGCTTTTATGG - Intergenic
967573893 3:191067174-191067196 CTGTGTAGTTGGAGCTATCTAGG - Intergenic
967713282 3:192734117-192734139 CTGTGTATTTGGAATTTTGAGGG - Intronic
967764499 3:193263424-193263446 TTATGAATTTTGAGCTATAAGGG + Intronic
969519379 4:7666947-7666969 GTGTTAATTTGGGGCTTTGAAGG + Intronic
970838552 4:20439655-20439677 ATGTGAATTGGGAGGTGTGAGGG + Intronic
971512007 4:27438113-27438135 CTCTGAGTTAGGTGCTATGATGG - Intergenic
972740982 4:41885842-41885864 AGGTGAGTTTGGAGCTAAGAAGG + Intergenic
973966859 4:56171866-56171888 CTGTGTGTTTGGAGCTATAAAGG - Intronic
974629583 4:64467337-64467359 CTGAAATTTTAGAGCTATGATGG + Intergenic
976366101 4:84234062-84234084 ATGAGAATTTAGAGCTAGGATGG - Intergenic
978061092 4:104340125-104340147 CTATTAATTTGGAGTTATGAAGG + Intergenic
978634619 4:110789572-110789594 TAGTGAATTTGAAACTATGATGG + Intergenic
980873366 4:138635493-138635515 CTGAGAATATGCAGCTATCATGG - Intergenic
980994064 4:139763779-139763801 CTGTAAAAGTGGAGCTATGGTGG + Intronic
982688460 4:158521234-158521256 CTGTGACTTTAGAGTTATGCAGG - Intronic
983481228 4:168277066-168277088 CTGTCAGTTTGGAGGTATTATGG + Intronic
983617001 4:169718445-169718467 CTGTGACTTTGAAGATATGCAGG - Intronic
984942053 4:184941439-184941461 CTGTGAATTGGTAGCACTGAGGG - Intergenic
986291836 5:6406437-6406459 CTATGAAATTGGAGCTGTCAAGG - Intergenic
989178517 5:38554242-38554264 CTGTGAAGTGGGAGCCATGATGG - Intronic
989816107 5:45739448-45739470 CTGTGAATTTGGAGATTTTGAGG + Intergenic
991494667 5:67215411-67215433 CCGTGAATGTGCAGCTATGCGGG + Intergenic
998392275 5:141795072-141795094 CTGGGCATTTGGAGCTCTTATGG - Intergenic
998807819 5:145936142-145936164 CTCTGAATTTAGAGATAAGAGGG - Intergenic
1003066301 6:2906081-2906103 CAGTGAACTTGGAGCTAGGAAGG - Intergenic
1013280714 6:108634410-108634432 CAGTGAATTTGGAGCAGGGAAGG - Intronic
1024767118 7:52672663-52672685 TTGTGAATTTGGAAATATCAAGG + Intergenic
1025639431 7:63353245-63353267 ATGTGAATTTTGAGACATGAAGG - Intergenic
1025643268 7:63394847-63394869 ATGTGAATTTTGAGACATGAAGG + Intergenic
1028473696 7:91231514-91231536 CTGTGAACTAGGACCTACGATGG + Intergenic
1029510512 7:100991835-100991857 CTGAGATTGTGGAGCTATCACGG - Exonic
1030299385 7:107960048-107960070 CTGTGATATTTGAGCTTTGAAGG - Intronic
1031932496 7:127700299-127700321 CTGTGAATTTGGATCCCTGAGGG + Intronic
1032328321 7:130952755-130952777 CTTTGAATTTGGTGCTTTCATGG - Intergenic
1032469073 7:132164939-132164961 CTGTGTCTTTGGAGCTATGATGG + Intronic
1033947602 7:146740984-146741006 TTCGGAATATGGAGCTATGAGGG + Intronic
1034784433 7:153912500-153912522 CTTTGAATTTGGTGCTTAGAAGG + Intronic
1034927833 7:155137297-155137319 CTTTGAATTTGGATCTTTGCTGG + Intergenic
1035247548 7:157573711-157573733 CAGTGAATTTGTGGCTACGATGG + Intronic
1035572062 8:679216-679238 CTGTGAGTTGGGAGCTGTGAGGG - Intronic
1037187716 8:16084165-16084187 CTGTGATTTTAGAGATGTGATGG + Intergenic
1037841357 8:22247308-22247330 CTCTGAATTTGGGGCTTTGGGGG + Intronic
1039243471 8:35582252-35582274 CGGTGAAATAGGAGCTATCATGG - Intronic
1039657619 8:39427125-39427147 CTGTGAAATAGAAACTATGAAGG + Intergenic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1041497518 8:58503290-58503312 CTGGGAATCTGGGGCTGTGATGG - Intergenic
1043191460 8:77227826-77227848 CACTGAATTTGGAGTTGTGAAGG + Intergenic
1046138704 8:110062481-110062503 CAGTGAATTTGGAGCCAGTAAGG + Intergenic
1047458200 8:125036184-125036206 CTGTGTATCTGGAACCATGATGG - Intronic
1048087855 8:131203347-131203369 CTGTGAATTTTGATATGTGAGGG - Intergenic
1048109676 8:131454091-131454113 GTGTGAGTTTGCAGCCATGATGG - Intergenic
1049261833 8:141643374-141643396 CTGTGAACTAGGAGATCTGAGGG - Intergenic
1050873439 9:10605317-10605339 CTATGAATTTGGAAATATAAGGG + Intronic
1053118033 9:35522592-35522614 CTGTGTATAAGGAGCTATGCTGG - Intronic
1056019198 9:82423895-82423917 CTTGGACTTTGGAGCTAGGATGG - Intergenic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1185746614 X:2578441-2578463 ATGTGGATTTGGAGCTAGGAGGG - Intergenic
1186629195 X:11330672-11330694 CTGTGAAATGGGAGCAATGGTGG - Intronic
1187239925 X:17503008-17503030 GTGTGCATTGGGAGCTATGGAGG - Intronic
1187840181 X:23479010-23479032 CTGAGATTTTGAAGCTGTGACGG + Intergenic
1196437709 X:115689928-115689950 CTCTGAATTGGATGCTATGAGGG - Intergenic
1197856329 X:130917480-130917502 ATGTGAAATTAGAGATATGAAGG + Intergenic
1199394778 X:147322893-147322915 CTGTGGATTTCAAGCTATGGTGG + Intergenic