ID: 1088749756

View in Genome Browser
Species Human (GRCh38)
Location 11:112833826-112833848
Sequence CTGAGTCAATACATCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088749753_1088749756 -6 Left 1088749753 11:112833809-112833831 CCTCACCCTTAGAGATTCTGAGT No data
Right 1088749756 11:112833826-112833848 CTGAGTCAATACATCTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088749756 Original CRISPR CTGAGTCAATACATCTGTGT TGG Intergenic
No off target data available for this crispr