ID: 1088749756 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:112833826-112833848 |
Sequence | CTGAGTCAATACATCTGTGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1088749753_1088749756 | -6 | Left | 1088749753 | 11:112833809-112833831 | CCTCACCCTTAGAGATTCTGAGT | No data | ||
Right | 1088749756 | 11:112833826-112833848 | CTGAGTCAATACATCTGTGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1088749756 | Original CRISPR | CTGAGTCAATACATCTGTGT TGG | Intergenic | ||
No off target data available for this crispr |