ID: 1088749806

View in Genome Browser
Species Human (GRCh38)
Location 11:112834196-112834218
Sequence TGGGATTCACTGACAAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088749798_1088749806 28 Left 1088749798 11:112834145-112834167 CCTTTTAAATACTACCCTCCTGC No data
Right 1088749806 11:112834196-112834218 TGGGATTCACTGACAAAGAGTGG No data
1088749803_1088749806 6 Left 1088749803 11:112834167-112834189 CCAAAGTGATTCAGAGGTGCACT No data
Right 1088749806 11:112834196-112834218 TGGGATTCACTGACAAAGAGTGG No data
1088749800_1088749806 13 Left 1088749800 11:112834160-112834182 CCTCCTGCCAAAGTGATTCAGAG No data
Right 1088749806 11:112834196-112834218 TGGGATTCACTGACAAAGAGTGG No data
1088749799_1088749806 14 Left 1088749799 11:112834159-112834181 CCCTCCTGCCAAAGTGATTCAGA No data
Right 1088749806 11:112834196-112834218 TGGGATTCACTGACAAAGAGTGG No data
1088749802_1088749806 10 Left 1088749802 11:112834163-112834185 CCTGCCAAAGTGATTCAGAGGTG No data
Right 1088749806 11:112834196-112834218 TGGGATTCACTGACAAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088749806 Original CRISPR TGGGATTCACTGACAAAGAG TGG Intergenic
No off target data available for this crispr