ID: 1088751561

View in Genome Browser
Species Human (GRCh38)
Location 11:112846476-112846498
Sequence ATGGTTAGACAGCTTCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088751556_1088751561 8 Left 1088751556 11:112846445-112846467 CCCTGACTAGTATAGAGGCCCAC No data
Right 1088751561 11:112846476-112846498 ATGGTTAGACAGCTTCCAGAAGG No data
1088751559_1088751561 -10 Left 1088751559 11:112846463-112846485 CCCACTTCACTTCATGGTTAGAC No data
Right 1088751561 11:112846476-112846498 ATGGTTAGACAGCTTCCAGAAGG No data
1088751554_1088751561 21 Left 1088751554 11:112846432-112846454 CCTCTCTGGAGAGCCCTGACTAG No data
Right 1088751561 11:112846476-112846498 ATGGTTAGACAGCTTCCAGAAGG No data
1088751557_1088751561 7 Left 1088751557 11:112846446-112846468 CCTGACTAGTATAGAGGCCCACT No data
Right 1088751561 11:112846476-112846498 ATGGTTAGACAGCTTCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088751561 Original CRISPR ATGGTTAGACAGCTTCCAGA AGG Intergenic
No off target data available for this crispr