ID: 1088754301

View in Genome Browser
Species Human (GRCh38)
Location 11:112872906-112872928
Sequence CTCCTGGCCTTGGGCACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088754295_1088754301 10 Left 1088754295 11:112872873-112872895 CCATTGACATCTCCTTTCTTGAA No data
Right 1088754301 11:112872906-112872928 CTCCTGGCCTTGGGCACAACTGG No data
1088754296_1088754301 -2 Left 1088754296 11:112872885-112872907 CCTTTCTTGAATCATTGTTTCCT No data
Right 1088754301 11:112872906-112872928 CTCCTGGCCTTGGGCACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088754301 Original CRISPR CTCCTGGCCTTGGGCACAAC TGG Intergenic
No off target data available for this crispr