ID: 1088754962

View in Genome Browser
Species Human (GRCh38)
Location 11:112878174-112878196
Sequence GTGTATTAGGTAAGGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088754958_1088754962 11 Left 1088754958 11:112878140-112878162 CCCAATGACTGTCTCTTTCTGAG No data
Right 1088754962 11:112878174-112878196 GTGTATTAGGTAAGGCTGCATGG No data
1088754959_1088754962 10 Left 1088754959 11:112878141-112878163 CCAATGACTGTCTCTTTCTGAGA No data
Right 1088754962 11:112878174-112878196 GTGTATTAGGTAAGGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088754962 Original CRISPR GTGTATTAGGTAAGGCTGCA TGG Intergenic
No off target data available for this crispr