ID: 1088758834

View in Genome Browser
Species Human (GRCh38)
Location 11:112910274-112910296
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088758832_1088758834 -1 Left 1088758832 11:112910252-112910274 CCGTGCATTATCTGTTTATAAAA No data
Right 1088758834 11:112910274-112910296 ATGAACAGGTCAAATTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088758834 Original CRISPR ATGAACAGGTCAAATTTGTT AGG Intergenic
No off target data available for this crispr