ID: 1088762626

View in Genome Browser
Species Human (GRCh38)
Location 11:112947008-112947030
Sequence ATGCAGTTCATGATGAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088762626_1088762635 22 Left 1088762626 11:112947008-112947030 CCCTATTTCATCATGAACTGCAT No data
Right 1088762635 11:112947053-112947075 GCATTAGACAGGAGGAAAAGAGG No data
1088762626_1088762632 14 Left 1088762626 11:112947008-112947030 CCCTATTTCATCATGAACTGCAT No data
Right 1088762632 11:112947045-112947067 GGGGCCCAGCATTAGACAGGAGG No data
1088762626_1088762628 -7 Left 1088762626 11:112947008-112947030 CCCTATTTCATCATGAACTGCAT No data
Right 1088762628 11:112947024-112947046 ACTGCATTTGCAAAGCAAAAAGG No data
1088762626_1088762631 11 Left 1088762626 11:112947008-112947030 CCCTATTTCATCATGAACTGCAT No data
Right 1088762631 11:112947042-112947064 AAAGGGGCCCAGCATTAGACAGG No data
1088762626_1088762630 -5 Left 1088762626 11:112947008-112947030 CCCTATTTCATCATGAACTGCAT No data
Right 1088762630 11:112947026-112947048 TGCATTTGCAAAGCAAAAAGGGG No data
1088762626_1088762629 -6 Left 1088762626 11:112947008-112947030 CCCTATTTCATCATGAACTGCAT No data
Right 1088762629 11:112947025-112947047 CTGCATTTGCAAAGCAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088762626 Original CRISPR ATGCAGTTCATGATGAAATA GGG (reversed) Intergenic
No off target data available for this crispr