ID: 1088763369

View in Genome Browser
Species Human (GRCh38)
Location 11:112952853-112952875
Sequence TAGAAAAAGCAAGGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088763369_1088763380 10 Left 1088763369 11:112952853-112952875 CCCTCCTCCCCTTGCTTTTTCTA No data
Right 1088763380 11:112952886-112952908 CCTGGCATTCTATTAGTTTCTGG No data
1088763369_1088763376 -8 Left 1088763369 11:112952853-112952875 CCCTCCTCCCCTTGCTTTTTCTA No data
Right 1088763376 11:112952868-112952890 TTTTTCTATCGTGGCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088763369 Original CRISPR TAGAAAAAGCAAGGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr