ID: 1088764496

View in Genome Browser
Species Human (GRCh38)
Location 11:112962583-112962605
Sequence GTGAACAATAGGGAGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088764487_1088764496 13 Left 1088764487 11:112962547-112962569 CCTTTCTTTGGGCGAGGTTCCCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 187
1088764485_1088764496 20 Left 1088764485 11:112962540-112962562 CCTGTCTCCTTTCTTTGGGCGAG 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 187
1088764490_1088764496 -7 Left 1088764490 11:112962567-112962589 CCGATCCTGGCAAAGTGTGAACA 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 187
1088764481_1088764496 26 Left 1088764481 11:112962534-112962556 CCTCGCCCTGTCTCCTTTCTTTG 0: 1
1: 0
2: 3
3: 80
4: 813
Right 1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 187
1088764484_1088764496 21 Left 1088764484 11:112962539-112962561 CCCTGTCTCCTTTCTTTGGGCGA 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 187
1088764489_1088764496 -6 Left 1088764489 11:112962566-112962588 CCCGATCCTGGCAAAGTGTGAAC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088764496 Original CRISPR GTGAACAATAGGGAGCTGGG AGG Intronic
900574614 1:3376901-3376923 ATGCCCAATAGGGGGCTGGGTGG - Intronic
902315884 1:15617889-15617911 GTGAAGAATTGGGGGCTGGGGGG + Intronic
903306557 1:22417149-22417171 GAGAAAAATGGGGAGCGGGGAGG - Intergenic
904300583 1:29550943-29550965 GTGCACAGCAGGGACCTGGGAGG + Intergenic
904317943 1:29677897-29677919 GTGACCAATAGGGATGTGGCAGG - Intergenic
904457623 1:30657101-30657123 GTGCACAGCAGGGACCTGGGAGG - Intergenic
905257142 1:36692155-36692177 GAGAACAATATGGAGGTGAGGGG - Intergenic
906764239 1:48412154-48412176 GTGAAAAATAGAGTGCTGGCTGG - Intronic
915348808 1:155212082-155212104 GTGGACACTAGGGAGCTGCAAGG - Intronic
915509226 1:156377503-156377525 GTGAACCTTGGGGAGCTGGGTGG - Intronic
915696179 1:157744807-157744829 GGGAACAATAGGGGGCAAGGTGG + Intergenic
920565548 1:206969901-206969923 CAGAATAATAGGGAGCTGAGAGG + Intronic
921254396 1:213325993-213326015 CTGAAGAAGAGGGAGCTGAGGGG - Intergenic
921498662 1:215872848-215872870 GGGAGCAAGAGGGCGCTGGGAGG - Intronic
923740916 1:236654455-236654477 GTGAACACGGAGGAGCTGGGGGG - Intergenic
1070781972 10:79142880-79142902 GTGCTCAATAGGGAGCTGCTCGG - Intronic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1072188291 10:93061924-93061946 GTGATCAAAAGGCAGCTGGAAGG + Intronic
1074293526 10:112160011-112160033 CTGAACAAGAGGGGACTGGGGGG - Exonic
1077071605 11:676428-676450 TTGTACAACATGGAGCTGGGTGG - Intronic
1080754407 11:35182279-35182301 GTGAACAGTAGGGATCAGAGTGG + Intronic
1081727623 11:45342205-45342227 GTGCACATTAAGGAGCTGGAAGG + Intergenic
1083160746 11:60852719-60852741 GTGGACGACAGCGAGCTGGGTGG - Exonic
1083423719 11:62571661-62571683 GTGAGCAATGAGGAGCTGCGGGG - Exonic
1084564849 11:69922838-69922860 GTGAAGATGAGGGAGCAGGGTGG + Intergenic
1086170003 11:83825645-83825667 GTGAACAAGATGGAGGTAGGAGG + Intronic
1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG + Intronic
1089289929 11:117431476-117431498 GTGAATGATGGGGAACTGGGGGG + Intronic
1091979587 12:4854277-4854299 CTGAAGCATAGAGAGCTGGGGGG + Intergenic
1095042912 12:37464101-37464123 GAGAACAAAAGAGAGCTAGGGGG - Intergenic
1096080490 12:48829273-48829295 GTGAACAAGAGGGGTATGGGGGG + Intergenic
1101838181 12:108309754-108309776 GGGAACAATAGGGAGGGGTGGGG - Intronic
1103355552 12:120317272-120317294 GGGAACAAAGGGGAGCTGAGAGG - Intergenic
1103535516 12:121631051-121631073 GGGAACAAAAGGGTGCTGGCGGG - Intronic
1106804695 13:33294069-33294091 GTGAAAATTAGGGAGCCTGGAGG + Intronic
1109912809 13:68938360-68938382 CTGTACAATAGCGAGCTGAGTGG - Intergenic
1112986656 13:105458273-105458295 GTGAGGAAGGGGGAGCTGGGGGG - Intergenic
1113584206 13:111452237-111452259 ATACACCATAGGGAGCTGGGAGG + Intergenic
1115199899 14:30841652-30841674 GTGTACATTAAGAAGCTGGGTGG - Intergenic
1115427420 14:33276434-33276456 GTTCATAATAGGGAGATGGGAGG - Intronic
1116866851 14:50038297-50038319 GTGAACAAGAGTCAGGTGGGCGG - Intergenic
1117239865 14:53819380-53819402 CTGAAGAATAAAGAGCTGGGTGG - Intergenic
1119080893 14:71692648-71692670 GTAAACGATGGGGAACTGGGAGG - Intronic
1119147745 14:72332216-72332238 GTGAACCATCTGGAGCTGGGAGG - Intronic
1119754288 14:77103853-77103875 GTGCACAGAAGGGAGTTGGGTGG - Intronic
1120314831 14:82878201-82878223 GTGTAGAATATGGAGTTGGGTGG + Intergenic
1122014192 14:98779762-98779784 GTGAACAATAGAGATTTGAGTGG + Intergenic
1202941450 14_KI270725v1_random:151704-151726 GAGAACAAAAGAGAGCTAGGGGG - Intergenic
1126292020 15:47091703-47091725 GAGAACAAAAGAGAGCTAGGGGG + Intergenic
1128154353 15:65383473-65383495 TTGGGCAATAAGGAGCTGGGAGG + Exonic
1129115265 15:73362074-73362096 GTGAACAGGAAGAAGCTGGGTGG - Intronic
1129987923 15:79935107-79935129 GAGAAAAATAGGGAGGGGGGTGG + Intergenic
1131350669 15:91696963-91696985 GTGCACACTGGGGACCTGGGTGG - Intergenic
1132224244 15:100128192-100128214 GAGAACAAAGGGGAGCTGGTGGG + Intronic
1132299270 15:100766368-100766390 GTGAAGAATTAGGAGCTGGACGG - Intergenic
1134834088 16:17346884-17346906 CTGAACAAAAGAGAACTGGGTGG - Intronic
1135251548 16:20904480-20904502 GTCAGCAATAGGGGGCAGGGAGG - Intronic
1135583742 16:23650849-23650871 GTGAACAATAGAGAGTGGTGGGG + Intronic
1135757553 16:25110653-25110675 GTGATCTTTAGGGAGCCGGGAGG - Intergenic
1139418361 16:66832241-66832263 GAGAACAATTGGGAGGGGGGTGG + Intronic
1143755509 17:9064421-9064443 GTGAGAAATGGGGAGCTGTGGGG - Intronic
1146339769 17:32008371-32008393 GAGAAAAAAAGGGAGTTGGGGGG - Intronic
1147642394 17:42011596-42011618 GTGAAGAAATGGGAGATGGGAGG - Intronic
1153258235 18:3194836-3194858 GTTAACAATAGGGATCTGTATGG + Intronic
1155918753 18:31581623-31581645 GTCAACAATAGTAATCTGGGTGG - Intergenic
1158197891 18:54909258-54909280 GCGACCAAAAGGTAGCTGGGGGG + Intronic
1158841105 18:61388591-61388613 GTGAAAAATAATGAGCTGTGAGG - Intronic
1159248781 18:65846304-65846326 GTAAAAAATATGGTGCTGGGTGG - Intronic
1159790318 18:72771174-72771196 GTGAACAAAAGGCAGATGGCAGG + Intronic
1165356112 19:35305154-35305176 GTGAAGAGTAGGGAGCTGGCAGG - Intronic
1165550047 19:36576164-36576186 GTGAACAACAGAGAGAAGGGAGG - Intronic
1165999200 19:39867826-39867848 GGGAAGCATAGGGAGCTGAGGGG + Intronic
1167932106 19:52874362-52874384 GTGATCCACAGGGAGCTGAGGGG - Intronic
1167945030 19:52981269-52981291 GTGATCCACAGGGAGCTGAGGGG - Intergenic
1168501884 19:56899784-56899806 GTGCACAGTGGGGAGCCGGGAGG + Intergenic
927293109 2:21423613-21423635 GTGGTCAATGGGAAGCTGGGGGG + Intergenic
927498383 2:23565500-23565522 GTAGGCAAGAGGGAGCTGGGGGG + Intronic
928114927 2:28539804-28539826 GTGAAGAACAGTGAGCGGGGAGG + Intronic
929425737 2:41842956-41842978 GGGAAGAATATGGAGCTAGGTGG - Intergenic
929614116 2:43294920-43294942 GTGAAGAACTGGGTGCTGGGAGG - Intronic
930539819 2:52691072-52691094 TTGAGCATTAGTGAGCTGGGAGG - Intergenic
931110532 2:59105899-59105921 GTGAATAATAGCTAGCTGGCTGG + Intergenic
934501565 2:94863870-94863892 GTAAGTACTAGGGAGCTGGGGGG + Intergenic
935165055 2:100562997-100563019 GTGCACAAAAGAGAGCTGAGGGG + Exonic
936000599 2:108825153-108825175 GTAAATAATAGGGAGGTGGGAGG + Intronic
937397219 2:121547386-121547408 GTGAAGAGTAGGGGGGTGGGTGG - Intronic
939730010 2:145772267-145772289 GTGACCAATAGGTAGATGGAGGG - Intergenic
942692089 2:178596393-178596415 TTGGACAGGAGGGAGCTGGGAGG + Intronic
944167961 2:196743197-196743219 GTGACCAATACAGAGCTGTGTGG - Intronic
944311423 2:198237865-198237887 CTGAACAAAAGGGAGCAGAGAGG - Intronic
946559143 2:220892801-220892823 GTGAAGAATTGGGGGCTGGCTGG - Intergenic
946704742 2:222447254-222447276 GTGAGAAGTAGGGAGGTGGGTGG - Intronic
947125190 2:226861341-226861363 GTCAACAGTGGAGAGCTGGGAGG + Intronic
947403639 2:229752725-229752747 TTGAAGAATGGGGAGCAGGGTGG + Intergenic
948008262 2:234629070-234629092 GGGATGAATGGGGAGCTGGGAGG - Intergenic
1168809413 20:694458-694480 GTGAACAAGGGGGTGCAGGGAGG + Intergenic
1169139953 20:3222066-3222088 GTGGACACTAGGAATCTGGGTGG + Intronic
1169185464 20:3612948-3612970 TGGAGCAATAGGGAACTGGGAGG - Intronic
1171382882 20:24746499-24746521 CTGAACAAAAGGAACCTGGGAGG - Intergenic
1171537334 20:25906856-25906878 GAGAACAAAAGAGAGCTAGGGGG - Intergenic
1171803776 20:29654430-29654452 GAGAACAAAAGAGAGCTAGGGGG + Intergenic
1171840287 20:30202195-30202217 GAGAACAAAAGAGAGCTAGGGGG - Intergenic
1172302026 20:33857113-33857135 GTGAAAAATCCCGAGCTGGGTGG + Intergenic
1172452232 20:35034435-35034457 GAGTACAGTATGGAGCTGGGTGG + Intronic
1172772902 20:37392035-37392057 GTGTACAACAAGGAGGTGGGTGG + Intronic
1173459934 20:43234927-43234949 TTGCAGAATAGGGAGCTTGGGGG + Intergenic
1176581711 21:8535230-8535252 GAGAACAAAAGAGAGCTAGGGGG + Intergenic
1177008288 21:15700666-15700688 GTTAAGAATAAGGAGCAGGGAGG + Intergenic
1179826355 21:43968427-43968449 GTGAGCAAGAGGGCCCTGGGTGG + Intronic
1180264546 22:10512302-10512324 GAGAACAAAAGAGAGCTAGGGGG + Intergenic
1180945004 22:19687994-19688016 GTGCACACTGTGGAGCTGGGTGG + Intergenic
1181821029 22:25475848-25475870 GTTAACAATGTGGAGCGGGGAGG - Intergenic
1182719719 22:32387292-32387314 GTGAACAAAATGGAGGTAGGTGG - Intergenic
1185166378 22:49265042-49265064 GGGGACAGTGGGGAGCTGGGTGG + Intergenic
1185412704 22:50694060-50694082 GTAACCAAAAGAGAGCTGGGTGG - Intergenic
950682894 3:14597277-14597299 ATGAGAAATAGGGAACTGGGTGG + Intergenic
954750219 3:52809378-52809400 ATGATGAATAGGTAGCTGGGGGG - Intergenic
954982644 3:54760396-54760418 GTGAGCAAGAGGGAGATGGCAGG + Intronic
955189811 3:56750244-56750266 GTGTAGAATAGGGAGCGGTGGGG + Intronic
955815230 3:62835298-62835320 GGGAACAACAGGGAGATTGGTGG + Intronic
958963943 3:100537297-100537319 GTGGGCAACAGGGAGCTGAGGGG + Intronic
962436430 3:135371429-135371451 GGGAACAGGAGGGAGGTGGGTGG - Intergenic
966641061 3:182191211-182191233 GAGAGGAATAGGGAGCTAGGTGG + Intergenic
967217522 3:187223052-187223074 GGGAACAATACGGAGCAGGAAGG + Intronic
969881257 4:10176051-10176073 GTGAACATGAGGGAGATGGATGG + Intergenic
969942012 4:10742101-10742123 GTGAAGAGTAGAGAGGTGGGAGG - Intergenic
971711694 4:30121189-30121211 GTAAAGAATATGGAGCTGGGTGG + Intergenic
973295723 4:48518606-48518628 GTGAACAAGAAGGAGAGGGGTGG - Intronic
973997141 4:56470022-56470044 GTGAACCATAGAGAGTTGTGGGG + Intronic
974538501 4:63200882-63200904 GGGAACAAGATGTAGCTGGGAGG - Intergenic
974584401 4:63853459-63853481 TTGAAAAATAGGTAGCTGGTAGG - Intergenic
980985287 4:139689243-139689265 GGGGACAAGAGGGAGCTGGGAGG + Intronic
982540674 4:156666196-156666218 GAGAACACAAGAGAGCTGGGTGG + Intergenic
984074779 4:175162784-175162806 TTGAACAACATGGAGCTGAGAGG + Intergenic
984534909 4:180962471-180962493 TTGAACAATAGGGAGGTTAGGGG + Intergenic
987274746 5:16350529-16350551 CCTAACAAAAGGGAGCTGGGAGG - Intergenic
988020218 5:25611652-25611674 GTAATCAAAAGAGAGCTGGGTGG + Intergenic
988372802 5:30393144-30393166 GTAAACAATAGGAAGCTGCTGGG + Intergenic
988854092 5:35210299-35210321 GGGAATAATAGTGAGCTGAGTGG - Intronic
989228928 5:39065245-39065267 GGGAGCAAGAGGGAGCTGGGGGG + Intronic
990444026 5:55876630-55876652 GTAAACAAAAGAGAGCAGGGTGG - Intronic
996748610 5:126867476-126867498 GGGAACAATAAGGATCTAGGAGG + Intergenic
998412385 5:141921467-141921489 GGGAAAAGTAGGGAGCAGGGAGG + Intergenic
999000958 5:147922404-147922426 GTGAGCAATGAGGAGCTGTGGGG + Intergenic
1000455460 5:161443109-161443131 GAGAAGAATAGGAAGCAGGGAGG - Intronic
1002840146 6:898491-898513 GAGAAGAACAGGGAGCAGGGAGG - Intergenic
1004299416 6:14443804-14443826 GTCAACAATAGGCAGCTCAGTGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007241960 6:40432701-40432723 GTGAACAACAACCAGCTGGGCGG - Exonic
1012255708 6:97028949-97028971 GAGAACCATAGGGATCTGAGAGG + Intronic
1015173311 6:130278754-130278776 CTGCACAATAAGGAGCTGAGAGG + Intronic
1017421528 6:154277889-154277911 GTGGACCACAGGAAGCTGGGCGG - Intronic
1017428921 6:154351347-154351369 GGGAACAAAAGGGGACTGGGGGG - Intronic
1018377518 6:163227266-163227288 AGGAACAAGAGGGAGGTGGGAGG + Intronic
1019574810 7:1732219-1732241 GGGAACATTGGGGTGCTGGGAGG + Intronic
1019587324 7:1812688-1812710 GTGCCCACTAAGGAGCTGGGGGG + Intergenic
1020154184 7:5708956-5708978 GAGAACAAGAGAAAGCTGGGTGG - Intronic
1021558758 7:21947440-21947462 GTGGACAATAAGGATCTGGAAGG - Intergenic
1025288810 7:57693690-57693712 GAGAACAAAAGAGAGCTAGGGGG - Intergenic
1029494274 7:100888945-100888967 GTGAACTACAGGCTGCTGGGTGG - Exonic
1029668191 7:102009358-102009380 GTGTACATTAGGGTGCTGTGCGG - Intronic
1029924719 7:104303384-104303406 GTGAAGGATAGGGGACTGGGAGG + Intergenic
1030110716 7:106024357-106024379 TTGAACAACAGAGAGCAGGGAGG - Intronic
1031046310 7:116891974-116891996 TTGAACAACAGGGAACTGGAAGG - Intronic
1031709995 7:125033681-125033703 GTGAGCAATGAGGAGCTGTGGGG + Intergenic
1032540337 7:132697588-132697610 GTGAAAATTCGGGTGCTGGGTGG + Intronic
1032574277 7:133035664-133035686 GTGAGCAATGAGGAGCTGCGGGG - Intronic
1036710847 8:11077674-11077696 CTTAATAAGAGGGAGCTGGGCGG - Intronic
1037563117 8:20092539-20092561 GAGAACAAGAGGGAGCTTGCTGG - Intergenic
1041935913 8:63331554-63331576 GTGGAATATAGAGAGCTGGGAGG + Intergenic
1042502454 8:69524129-69524151 GTGGACAATAGAGAGCATGGAGG + Intronic
1043856089 8:85266600-85266622 GTGAACAACATGGAGCTGAAAGG - Exonic
1045314812 8:101034327-101034349 GTGAACAGCAGGAACCTGGGAGG + Intergenic
1048340291 8:133533548-133533570 GGGAGGAATGGGGAGCTGGGAGG - Intronic
1049231715 8:141488243-141488265 GGGAACAAGAGGGAGCAGGGAGG - Intergenic
1049703975 8:144030107-144030129 GTAATCAAAAGAGAGCTGGGTGG - Intronic
1049753314 8:144296126-144296148 GTGGACAATTGGGAGCAGAGTGG + Intronic
1051956717 9:22703909-22703931 GTTGACAATGGGGAACTGGGAGG + Intergenic
1052221324 9:26026770-26026792 CTGAAGAATAGGGAGCTCGGAGG + Intergenic
1055228223 9:74027499-74027521 GTGTAAAATAGGGGGCTGAGTGG + Intergenic
1055995930 9:82160054-82160076 GGGAACAATAAGGAGATGGAAGG + Intergenic
1056792887 9:89637721-89637743 GTGGACAATAGGGAGGGGTGGGG - Intergenic
1057726086 9:97569164-97569186 GTGAACTTTAGGGACCTTGGAGG - Intronic
1059305628 9:113350988-113351010 CTGAACATTAGGAAGCTTGGAGG - Intronic
1059422319 9:114199979-114200001 GGCAACAGGAGGGAGCTGGGGGG - Intronic
1060010558 9:120039882-120039904 GGGAAAACTAGGGAGGTGGGAGG - Intergenic
1060093501 9:120765830-120765852 GAGAAAAGTAGGGAGTTGGGAGG + Intronic
1061902216 9:133678719-133678741 GTGAAGAATGGGGAGCCGTGTGG - Intronic
1062009060 9:134257347-134257369 GTGCACAACGGGGAGCTGGGTGG + Intergenic
1203611730 Un_KI270749v1:13267-13289 GAGAACAAAAGAGAGCTAGGGGG + Intergenic
1186566319 X:10666702-10666724 GTGAAGAAAAGGGAGCTCAGAGG + Intronic
1188462751 X:30447637-30447659 GGGAACATTAGGGAGCGGGGTGG + Intergenic
1192149254 X:68701757-68701779 GTGGAGAACAGGGTGCTGGGTGG + Intronic
1192452694 X:71253692-71253714 GTAAAGACTGGGGAGCTGGGGGG - Intronic
1194262263 X:91710848-91710870 GTTAAGAATAGGGAGTTGTGAGG - Intergenic
1195081854 X:101378709-101378731 TTGCTCCATAGGGAGCTGGGAGG - Intronic
1195705573 X:107735727-107735749 GAGAGCAATAGTCAGCTGGGGGG - Intronic
1195880336 X:109586529-109586551 GAGAACAGGAGGGAGGTGGGTGG - Intergenic
1198506101 X:137302820-137302842 GGGAATAATAAGGATCTGGGTGG + Intergenic
1200316944 X:155144311-155144333 GTGAACAATAGGTAGGTTTGTGG + Intronic
1200581557 Y:4955681-4955703 GTTAAGAATAGGGAGTTGTGAGG - Intergenic