ID: 1088765033

View in Genome Browser
Species Human (GRCh38)
Location 11:112966706-112966728
Sequence CTCAGCTGCAGATGCTCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088765032_1088765033 9 Left 1088765032 11:112966674-112966696 CCTTTTCATTTCATGTTGTTGAA 0: 1
1: 1
2: 3
3: 71
4: 836
Right 1088765033 11:112966706-112966728 CTCAGCTGCAGATGCTCATTAGG 0: 1
1: 0
2: 2
3: 20
4: 182
1088765031_1088765033 17 Left 1088765031 11:112966666-112966688 CCATTATGCCTTTTCATTTCATG 0: 1
1: 1
2: 2
3: 40
4: 436
Right 1088765033 11:112966706-112966728 CTCAGCTGCAGATGCTCATTAGG 0: 1
1: 0
2: 2
3: 20
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088765033 Original CRISPR CTCAGCTGCAGATGCTCATT AGG Intronic
900351302 1:2236087-2236109 TGCAGCTGCAGATGCTGAATCGG + Intronic
900393659 1:2444390-2444412 CTGGGCTGCAGGTGCTCATCTGG + Intronic
901122804 1:6908784-6908806 CTCCCCTGCAGCTGCTCAGTGGG + Intronic
902080974 1:13820573-13820595 CTCAGCTGTTGCTGCTCCTTTGG + Intronic
902110491 1:14074411-14074433 CTCAGCTGGAGATGGTCAAGGGG - Intergenic
903268407 1:22172600-22172622 CTCAGATGCAGATGCTTCCTGGG - Intergenic
904395614 1:30219484-30219506 CTCCTCTGCTGATTCTCATTAGG - Intergenic
906068086 1:42996628-42996650 CTCACCTGCTGATGAACATTTGG - Intergenic
910750828 1:90628168-90628190 CTCAGCTGCAACTGCTCTGTGGG + Intergenic
912561596 1:110555405-110555427 CCCAGCTGCACAGGCTCAGTCGG + Intergenic
913179446 1:116307226-116307248 CTGAGCTGGAGAGGCACATTTGG - Intergenic
915513935 1:156401945-156401967 CTCATCTGCATATGCTCAGTGGG + Intergenic
916713812 1:167433906-167433928 CCCAGCTGCAAATGCCCATGTGG - Intronic
921872023 1:220151705-220151727 CTCAGCTGCTGGTGCTCACGGGG - Exonic
923155926 1:231279422-231279444 TTCTGCTGCAGAGCCTCATTTGG - Intergenic
923302018 1:232650214-232650236 GTCAGCTGGAGAAGCTCAATAGG - Intergenic
923806923 1:237267691-237267713 CTAAGGTGCAGATTCTGATTGGG - Intronic
1063411289 10:5838629-5838651 CTCATCTGCGGATGCACATTTGG - Intronic
1064151640 10:12870613-12870635 CTCAGTTGCTGATGCTCCTTTGG + Intergenic
1065819085 10:29508767-29508789 CACAGCTGCAGAAGCACAGTGGG + Intronic
1066006497 10:31150755-31150777 CTCAGCTGCAGAAGGTCGTTTGG + Intergenic
1069422711 10:68261194-68261216 CTCATCTGGAGCTGCTCATGTGG - Intergenic
1069601331 10:69710079-69710101 CTCAGGTGCAGATTCTGATTTGG + Intergenic
1070332459 10:75428087-75428109 CTCAGCTGCTAATGCACAGTTGG + Intergenic
1070623807 10:78034221-78034243 CTCGTCTGCAGTTCCTCATTGGG + Intronic
1073256010 10:102151846-102151868 CTCTGCTGCAGAAGATCCTTCGG - Intergenic
1073901123 10:108222243-108222265 CTCAGTTGCAGTTAATCATTTGG - Intergenic
1074423404 10:113329325-113329347 CCAAGCTGCAGATACTCTTTTGG + Intergenic
1075714561 10:124548550-124548572 CTCAGCTGCAGGTGCACAGTGGG - Intronic
1076485075 10:130810544-130810566 CCCAGCTCCAGAGGCCCATTGGG + Intergenic
1077317297 11:1925251-1925273 CTCAGCTGCAGAAGTCCATGAGG + Intronic
1078266624 11:9759751-9759773 CTCAGCTGCACATGGTGACTGGG - Intergenic
1078870954 11:15344246-15344268 CTCATCTGCTGATGCTCATATGG - Intergenic
1079666556 11:23113422-23113444 CACACCTGCAGCTGCACATTTGG - Intergenic
1082115041 11:48319089-48319111 CTGAGAAGCAGATGCTAATTTGG + Intergenic
1085338603 11:75716913-75716935 CAGAGCTGCAGATGCAGATTTGG + Intergenic
1085515450 11:77109052-77109074 CTTAGCTCCAGAAGCTCATACGG + Intronic
1085968037 11:81552923-81552945 CTCAGCAGCTGATGATAATTAGG - Intergenic
1088685709 11:112282916-112282938 TTCAGCTGCAGCTGCTGCTTTGG + Intergenic
1088765033 11:112966706-112966728 CTCAGCTGCAGATGCTCATTAGG + Intronic
1089180858 11:116581927-116581949 CTGAGCCTCAGTTGCTCATTAGG - Intergenic
1090140396 11:124252806-124252828 CACAATTTCAGATGCTCATTTGG + Intergenic
1091233236 11:134001831-134001853 CTGAGCTGCCTCTGCTCATTAGG + Intergenic
1097159782 12:57038037-57038059 CCTCGCTGCTGATGCTCATTGGG + Exonic
1099670469 12:85685369-85685391 CTCTGCTGTATTTGCTCATTCGG - Intergenic
1099865059 12:88269640-88269662 CTCAGCTCTAGATGGCCATTTGG + Intergenic
1105303207 13:19153043-19153065 CGGAGCTGCATATGCTCATGGGG + Intergenic
1105400766 13:20092994-20093016 CTCAGCTGCCGATGTGCAGTTGG - Intergenic
1105563978 13:21525014-21525036 CTCACCTGCTGATGGACATTTGG + Intronic
1105779096 13:23690796-23690818 TGCAGCTGCAGATGCTCACTGGG - Intergenic
1106300850 13:28463536-28463558 ATAATCTGCAGATGCTTATTGGG + Intronic
1107219069 13:37959437-37959459 CTCATCAGCACATGCTCATGAGG - Intergenic
1107543187 13:41412308-41412330 CTCACCTGCTGATGGACATTTGG - Intergenic
1108011439 13:46017042-46017064 CTCAGATGGAGATGCCCAGTTGG + Intronic
1108655770 13:52531099-52531121 TACAGCTGCAAATGCACATTAGG - Intergenic
1111592454 13:90367772-90367794 CTCAGCTGCAGAACCCAATTAGG + Intergenic
1115972673 14:38963323-38963345 CTGGGCTGCAGATGCACTTTGGG - Intergenic
1116457715 14:45138105-45138127 TTCAGCTGTAGATATTCATTAGG + Intronic
1116658862 14:47682187-47682209 CTCAGCTGCATAGGTTTATTTGG - Intergenic
1116788186 14:49310745-49310767 CTCAGTTGCATATGCTCAGTTGG + Intergenic
1117815557 14:59593951-59593973 CTCACAGGCAGCTGCTCATTAGG - Intergenic
1119185337 14:72637411-72637433 CTCAGCTGCAGTGACTAATTAGG - Intronic
1127489010 15:59444527-59444549 CTCACATTCAGCTGCTCATTTGG - Intronic
1128422345 15:67505575-67505597 CTCATCTGCTGATGGACATTTGG - Intergenic
1128900256 15:71414348-71414370 GTCAGATGCACATGCTCTTTTGG + Intronic
1129564812 15:76610116-76610138 CTCAGTTGCAGAGGCTCTTGGGG - Intronic
1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG + Intronic
1135865763 16:26100427-26100449 CTCAACTGCAAATGCTATTTGGG + Intronic
1135980592 16:27143869-27143891 CTCTGCTGCTGCTGTTCATTGGG - Intergenic
1136655717 16:31707994-31708016 CCAAGCTGCAGATGTTCATGTGG + Intergenic
1143871612 17:9960644-9960666 CTCACCTGCAGATGGTCATTTGG - Intronic
1145103765 17:20098068-20098090 CCCAGCTGGAGATGCAAATTTGG - Intronic
1147371244 17:39994558-39994580 GTCAGCCAGAGATGCTCATTAGG - Intronic
1147443689 17:40462361-40462383 CTCAGCTGCAGATTGTCAAGTGG + Intergenic
1149592598 17:57842725-57842747 CTCAGCTGGAGAATGTCATTTGG - Intronic
1149638121 17:58186349-58186371 CTCTGCTGCAGTTGCTCCTAAGG - Intergenic
1152482467 17:80563984-80564006 CTCACCTGCTGATGGACATTTGG + Intronic
1152717790 17:81908180-81908202 CTCAGCTGCAGATGCTCAGCGGG - Intronic
1152717792 17:81908209-81908231 CTCAGCTGCAGCATCTCATGCGG + Intronic
1154139108 18:11807669-11807691 CTAAGCTGGAGATGTCCATTTGG + Intronic
1154147437 18:11877905-11877927 TTCAGCTGCAGAAGCTCTCTGGG - Intronic
1156513153 18:37658467-37658489 CTCAGCTCAGGATGCACATTTGG + Intergenic
1157017586 18:43735895-43735917 TTCAGCCGCAGATGATAATTGGG + Intergenic
1157422005 18:47555350-47555372 TGCAGCTCCCGATGCTCATTTGG - Intergenic
1160555868 18:79724817-79724839 CTCAGCCCCAGATGCTCTTGAGG + Intronic
1165258350 19:34593440-34593462 CTGAGCTGCAGGTGTTCATTGGG + Exonic
1166644452 19:44520596-44520618 GACAGCTGCAGGTGCTCACTGGG + Exonic
1167671747 19:50857466-50857488 CTCAGCTGTAGATGCGGCTTTGG - Intronic
925659255 2:6184719-6184741 CACAGCTGCAGGTGCTCACCAGG - Intergenic
925783958 2:7410263-7410285 CTCAGCCCCTGATGCTCATAGGG + Intergenic
926291861 2:11538123-11538145 CAGAGCTGCAGATGCTCGCTCGG + Intronic
926311389 2:11678490-11678512 CTCAGCTGCAGAGGCTGAGATGG + Intronic
929005047 2:37385858-37385880 CTCAGCTTTAGATTCTCCTTGGG + Intergenic
929256945 2:39821978-39822000 TTCAGCTTCATATTCTCATTAGG + Intergenic
930472266 2:51832798-51832820 CTCAGCAGAAAATACTCATTGGG - Intergenic
931621167 2:64211123-64211145 CTGAGCTGGAGGTGCACATTTGG - Intergenic
931623281 2:64232345-64232367 CTGAGCTGGAGGTGCACATTTGG + Intergenic
932054084 2:68427106-68427128 CTCATCTGAAGTTGCTCATCAGG + Intergenic
932427328 2:71646334-71646356 CTCAGGTGCGGATGCTGAATTGG + Intronic
934612618 2:95752377-95752399 CTGAGCTGCAGCTGCTCCTCCGG + Intergenic
934620245 2:95799183-95799205 CTCAGGTGCAGACACTCACTTGG - Intergenic
934648297 2:96072046-96072068 CTGAGCTGCAGCTGCTCCTCCGG - Intergenic
939466420 2:142562326-142562348 GCCAGCTTCAGATGCTCCTTGGG + Intergenic
939728558 2:145753561-145753583 CTCTGCTGCAGCTGCTCTTCAGG + Intergenic
940427853 2:153551328-153551350 CTCAGCTCCAAATGCTCTATTGG - Intergenic
940841369 2:158585439-158585461 GTCATCTGCAGATGCCCATCAGG + Intronic
941742519 2:169050340-169050362 CTCATCTGCTGATGAACATTTGG - Intergenic
942331521 2:174829729-174829751 TTCAGCTGCAGCTTCTCATTTGG + Intronic
943618902 2:190125263-190125285 TTCAGCTGCAGATAATCATATGG + Intronic
945231464 2:207594611-207594633 CTCATCTGCTGATGGACATTTGG + Intronic
946358374 2:219203593-219203615 CTGAGCTGCAGCCTCTCATTGGG - Intronic
946678179 2:222184773-222184795 CTCAGCTTCTGAAGCTCATGTGG - Intergenic
948240495 2:236429271-236429293 GTCAGCTGCAGGTGCACATGTGG + Intronic
1168793967 20:598719-598741 CACAGCTGCTGAGGCTCATAGGG + Intergenic
1169146454 20:3255670-3255692 CTCTTCTGCAGATGCTCACTAGG - Intronic
1169148492 20:3270480-3270502 TTCAGCTGCAGAGCCTCATCAGG - Exonic
1171087595 20:22252286-22252308 CTCAGCTGGAGATGATGACTGGG - Intergenic
1172182133 20:33009965-33009987 CTCAGCTGCAGATGGTTAGGTGG + Intronic
1173469150 20:43309240-43309262 CTCAGCTTGAGATCCTCAGTGGG + Intergenic
1176189234 20:63800041-63800063 CTCACCTGTTGATGCACATTTGG - Intronic
1179508173 21:41855568-41855590 CTCAGCAGCTGGTGGTCATTAGG - Intronic
1179944815 21:44666026-44666048 CGCAGCTGCAGATGCCCATGTGG - Intronic
1179946461 21:44681414-44681436 CGCGGCTGCAGATGCCCATGTGG - Intronic
1181099659 22:20530835-20530857 GGGAGCTGCACATGCTCATTGGG + Intronic
1181350134 22:22249248-22249270 CTAATCTGCAGATTCTCAGTGGG + Intergenic
1181665595 22:24394077-24394099 TTCAGCTGCTGATGGACATTTGG + Intronic
949806571 3:7961902-7961924 CTCAGGTGCATATGCTCCCTGGG - Intergenic
950876270 3:16277324-16277346 CTCAGCAGTATATGGTCATTAGG + Intronic
953656665 3:44859860-44859882 CTAAGATGAAGATTCTCATTAGG - Intronic
954330041 3:49884961-49884983 ATGAGCTGCAGAAGCTCAATGGG + Intergenic
954932090 3:54292924-54292946 CTCATCTGTTGATGCACATTCGG - Intronic
955923201 3:63980088-63980110 CTGAGCTGCAGTTTCTCTTTGGG - Exonic
958260062 3:91369585-91369607 CTCAGCTGGAGATACAAATTTGG + Intergenic
961623795 3:128245180-128245202 CTGAGCTGCAGCAGCCCATTAGG + Intronic
961924665 3:130465182-130465204 CTCAGCTCCAGGAGCTCACTGGG - Intronic
964603118 3:158525653-158525675 TTCACCTGCAGATGAACATTTGG - Intronic
965242057 3:166214197-166214219 CTGATATGCAGATGCTCATGAGG + Intergenic
967259546 3:187628458-187628480 CTGAGCTGCAGATGACCAGTGGG - Intergenic
969257301 4:6011157-6011179 CTCAGGGTCAGATGGTCATTTGG - Intergenic
971345518 4:25808721-25808743 CTGACCTGGAGATCCTCATTGGG + Intronic
971500934 4:27317129-27317151 CTCTGCTCCACATGGTCATTCGG - Intergenic
972135459 4:35887510-35887532 CTTAGTTGCAGATGCAAATTTGG - Intergenic
974622217 4:64372248-64372270 CCCAGCTGCAAATCCTCAGTTGG - Intronic
976016800 4:80565232-80565254 CTCAGCTGCTGATAGTCATTGGG - Intronic
977687722 4:99868301-99868323 ATCAGAAGCAGATGCTGATTGGG + Exonic
979944292 4:126807279-126807301 CTCAGGGACAGATGCTCAGTGGG + Intergenic
980184016 4:129438868-129438890 ATCAGCAGAAGATACTCATTGGG + Intergenic
984363661 4:178770764-178770786 CTCAGCTGCAGAGACACACTTGG - Intergenic
985025797 4:185737872-185737894 CTCAGCTACAGAAACACATTTGG + Intronic
986963145 5:13239602-13239624 CTCAGCAGCAGTTGCTCCTGAGG + Intergenic
987525644 5:19045787-19045809 CTTAGCTCCAGATGGTTATTGGG - Intergenic
988008375 5:25449481-25449503 CTTAGCTGAAAATGCTCATTAGG - Intergenic
990137841 5:52668770-52668792 ATCAGCTGAAGATGCTCCTCAGG + Intergenic
990523899 5:56606204-56606226 CTCAGGTGAAGTTGTTCATTTGG + Exonic
992226050 5:74620553-74620575 CTCACCTCCAGATGCTACTTTGG - Intergenic
994892623 5:105657535-105657557 CTCAGCTGCAGATGCTTCTCAGG + Intergenic
1000277335 5:159749723-159749745 CTCATCTGAGGATGCTAATTAGG + Intergenic
1002494482 5:179602445-179602467 CTCTGCTGCAGGTGCTGATGGGG + Intronic
1002506656 5:179683980-179684002 TTCAGCTGTTGATGCACATTTGG + Intronic
1002987356 6:2203404-2203426 CTCAGCTGCTGACTCTCACTAGG - Intronic
1003253813 6:4457111-4457133 CACATCTGGAGATGCTGATTTGG - Intergenic
1004435408 6:15588086-15588108 CTCAGCAGCTGATGGACATTTGG - Intronic
1008995173 6:57650817-57650839 CTCAGCTGGAGATACACATTTGG - Intergenic
1009183710 6:60549577-60549599 CTCAGCTGGAGATACAGATTTGG - Intergenic
1010902658 6:81446855-81446877 CTCAGGTACAGATTTTCATTAGG + Intergenic
1011649225 6:89490633-89490655 CTCCGGAGCAGGTGCTCATTAGG - Intronic
1012027223 6:94010974-94010996 ATCAGCTGCAGATCATCTTTAGG - Intergenic
1012510423 6:99994748-99994770 CTCATCCTCAGTTGCTCATTTGG + Intergenic
1012533549 6:100267977-100267999 CTGAGCTCCAAATGCACATTTGG + Intergenic
1015954199 6:138583237-138583259 CTCAGCTGCAGAAGCTTCCTAGG + Intronic
1016627836 6:146193231-146193253 CTGGGCTGAAGATGCACATTTGG + Intronic
1017059245 6:150466165-150466187 CTCACCTGCTGATGGACATTTGG + Intergenic
1017423081 6:154293310-154293332 CGCAACTGCAGATGCTTATCTGG + Intronic
1018707605 6:166474504-166474526 AGAAGCTACAGATGCTCATTAGG + Intronic
1026300717 7:69095728-69095750 CTCAGCTGCATAGGCTCAAGAGG + Intergenic
1027367854 7:77477154-77477176 TTCAGATGCAGATGGTCCTTAGG + Intergenic
1029576731 7:101408300-101408322 CCCAGCTGCAGAGCCTCATGGGG - Intronic
1030949796 7:115775661-115775683 GTCAGCTGCAGATGGACATCTGG + Intergenic
1031279030 7:119772163-119772185 CTCTGCTTCAGATTCTTATTAGG - Intergenic
1032858902 7:135859167-135859189 CTCAGGTGCAGATGCTGAGGTGG - Intergenic
1034419913 7:150984803-150984825 CTCAGCAGCTGATGATCCTTGGG - Intergenic
1037248690 8:16866894-16866916 CTCAGCTGCAGACTCTCCTTGGG + Intergenic
1038397181 8:27255381-27255403 CTTACCTGGAGATTCTCATTTGG - Intronic
1039194838 8:35019608-35019630 CTAAGCTGCAGATGCTAACAAGG + Intergenic
1040896708 8:52375697-52375719 CTTGGCTGCAGAAGCACATTTGG - Intronic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1044728321 8:95210704-95210726 CTCAGCTCCACAAGGTCATTCGG + Intergenic
1048477447 8:134756282-134756304 CTCACCTCCAGATTCTCATTTGG + Intergenic
1048539199 8:135327119-135327141 CTCAGCTGGAGATGCAGGTTAGG - Intergenic
1048541574 8:135346733-135346755 CTTCTCTTCAGATGCTCATTTGG - Intergenic
1051443923 9:17120122-17120144 CTCACCTGCTGATGGACATTTGG - Intergenic
1052112107 9:24599077-24599099 CTCAGGTGCTGCTGCTGATTTGG + Intergenic
1055079216 9:72251246-72251268 CTCAGCTGCAGTTGCCAATGGGG - Intronic
1057860458 9:98636823-98636845 CTCAGAAGCAGATGTTCCTTTGG + Intronic
1057871974 9:98725269-98725291 CCCAGCTGCAGAGGCTCAGAGGG + Intergenic
1058092598 9:100822494-100822516 TTCAGCTGCAGATATTCAATAGG - Intergenic
1059416270 9:114164423-114164445 TTTAGCTGCAGATGGTCTTTGGG + Intronic
1060432176 9:123560084-123560106 TTCATCTGCAGATGGACATTTGG + Intronic
1186538737 X:10377195-10377217 CTCAGCTGAAGATGCCCTTAAGG - Intergenic
1188980601 X:36723709-36723731 TTCAGCAGGAGATGCACATTTGG + Intergenic
1189800178 X:44684741-44684763 CTCTGTTGCAGATACTCAGTGGG - Intergenic
1189827167 X:44931456-44931478 CACATCTGCTGATGCTCATTTGG - Intronic
1198714387 X:139540997-139541019 CTCCCCTGTAGATACTCATTGGG - Intronic
1199683126 X:150241190-150241212 CTAAACAGCACATGCTCATTTGG + Intergenic
1200847719 Y:7849310-7849332 GTTAGCTGGAGATACTCATTGGG - Intergenic