ID: 1088765333

View in Genome Browser
Species Human (GRCh38)
Location 11:112970017-112970039
Sequence CCACAGATATGAAGGTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088765333 Original CRISPR CCACAGATATGAAGGTAAAT AGG Intronic
901889400 1:12249713-12249735 CCACGAATATGAAGGTCAAAGGG - Intronic
905346756 1:37316516-37316538 CCACAGAGAAGAAGGAACATTGG - Intergenic
905575609 1:39042148-39042170 CCACAAAAATGAAAGTATATGGG - Intergenic
905644660 1:39616934-39616956 CGACAGAGATGAGGGTCAATGGG + Intergenic
908014697 1:59818890-59818912 TCACAGAAATCAAGGAAAATGGG - Intronic
909033703 1:70572208-70572230 CCACACATGTGAAGGCAAGTTGG + Intergenic
909906329 1:81200235-81200257 CCACAGGTATGAACTTGAATAGG + Intergenic
910818797 1:91322949-91322971 CAAGAGAAATGAAAGTAAATTGG - Exonic
911101145 1:94096710-94096732 CCAGAGATAGTAGGGTAAATCGG - Intronic
911702729 1:100973326-100973348 CCACAGAATAAAAGGTAAATTGG - Intronic
913060290 1:115198177-115198199 CTAGAGGTATGAAGATAAATAGG - Intergenic
915610323 1:156986709-156986731 ACAAAGAGATGAAGCTAAATGGG - Intronic
915632979 1:157166319-157166341 CCACAGATATGAAGGGGACCAGG + Intergenic
915657322 1:157371999-157372021 TCACAGATATGAACATTAATGGG + Intergenic
915863828 1:159477013-159477035 ACACAGAAATGATGGTAAGTGGG - Intergenic
916885419 1:169062876-169062898 CCACTGATGGGAATGTAAATTGG + Intergenic
917148722 1:171921868-171921890 CCACACCTATGAAGGCAAAAGGG - Intronic
917525899 1:175788224-175788246 CTACTGATATGATGCTAAATTGG - Intergenic
918158541 1:181874370-181874392 CCAAAAATATCAAGGTAAACAGG + Intergenic
918170354 1:181990800-181990822 CCACAGATAAGAAGAAAATTTGG + Intergenic
918315055 1:183316466-183316488 CCACAGACATGAAAGAAAATGGG - Intronic
918514850 1:185352233-185352255 ACACATATATGAAGTTAAAGAGG - Intergenic
918620594 1:186600019-186600041 CCACAGATATTATACTAAATGGG - Intergenic
918699043 1:187583733-187583755 CTACAGATAAGTATGTAAATAGG + Intergenic
920970503 1:210739503-210739525 CCTCAGAGATGAAGCTAACTTGG + Intronic
921133801 1:212242452-212242474 GCAAAGATATGAAGATAAAGAGG - Intergenic
924774913 1:247109678-247109700 CCACAGCTATTAAAGTAAATAGG - Intergenic
1067192107 10:44080295-44080317 CCACAGACATGAAGGGACAGGGG + Intergenic
1069738056 10:70670457-70670479 CCCCAGATTTGGAGGTGAATGGG - Intergenic
1072578931 10:96723265-96723287 TTACAGATAAGAAGTTAAATAGG + Intergenic
1073949164 10:108786377-108786399 CCCCAGAGATGAAGGTTACTGGG + Intergenic
1073950439 10:108802794-108802816 TCAGAGAAATGAAGGAAAATTGG + Intergenic
1074388953 10:113040545-113040567 CAACAAATATTAAGATAAATTGG - Intronic
1074459234 10:113621899-113621921 CCACAGACATGAAGGTGGAATGG - Exonic
1075096814 10:119477216-119477238 CCAAAGAAATGAAGATATATGGG - Intergenic
1075542362 10:123325560-123325582 CATGAGATATGAAGGTAGATGGG - Intergenic
1075926775 10:126257582-126257604 CCACAACTATAAAGGAAAATGGG + Intronic
1081648911 11:44810065-44810087 CCAATGATATGAAGGCAAACGGG - Intronic
1084838307 11:71822712-71822734 ACATAGATATGTAGGTATATAGG + Intergenic
1085857036 11:80186772-80186794 AAATAGATAGGAAGGTAAATGGG + Intergenic
1087601365 11:100320156-100320178 CCATTGATAGGAATGTAAATTGG - Intronic
1088765333 11:112970017-112970039 CCACAGATATGAAGGTAAATAGG + Intronic
1088952963 11:114589197-114589219 CCCCAGAGATGAAGGTCAACAGG + Intronic
1090918166 11:131185465-131185487 GCACAGTGATGAAGGTCAATGGG + Intergenic
1092034494 12:5319978-5320000 CCACAGATATGAAGGGTAATTGG + Intergenic
1092400392 12:8171374-8171396 ACATAGATATGTAGGTATATAGG - Intronic
1095257584 12:40057543-40057565 CTACAGAAATCCAGGTAAATGGG + Intronic
1097242098 12:57582608-57582630 CCACAGATATCAATGACAATAGG + Exonic
1098489930 12:71063769-71063791 CCACAGATTTCAAGTTATATAGG + Intronic
1100096300 12:91041843-91041865 CCACAGATTTGAAGGAAAACTGG + Intergenic
1106815391 13:33401844-33401866 CCACAAAGATGAAGTTTAATGGG - Intergenic
1107356791 13:39575905-39575927 CCACACATTTGAAAGTAAACTGG - Intronic
1107837211 13:44421690-44421712 CCACAAACATGAATATAAATAGG - Intergenic
1108457695 13:50633097-50633119 CTACAGATATGTAGGGAAAATGG + Intronic
1110173099 13:72525695-72525717 TCACAGATATGAAAATAAAAAGG - Intergenic
1110497350 13:76184289-76184311 CCAAAGAGAGGAAGGTGAATGGG + Intergenic
1110720495 13:78755738-78755760 ACACAGTTAAGAAGGGAAATAGG - Intergenic
1111152621 13:84276506-84276528 CCACAGAGATAGAGGAAAATAGG - Intergenic
1112234695 13:97624844-97624866 CCATAGATAGGTAGGTAGATAGG + Intergenic
1113088220 13:106590471-106590493 ATACAGAAATGAAGATAAATAGG - Intergenic
1114217529 14:20667953-20667975 CCACAGATATGAAGCTCCACTGG + Intergenic
1114262608 14:21049057-21049079 CCAAAGATATGAAAATAAGTTGG + Intronic
1114937814 14:27565865-27565887 ACACTGTTAGGAAGGTAAATTGG + Intergenic
1115131432 14:30056735-30056757 CCACAGCCATGAAGGTGGATGGG - Intronic
1116423156 14:44757162-44757184 CCACAGGTAGAAAGATAAATAGG + Intergenic
1118511898 14:66484244-66484266 GAACAGAAATGAAGGTAAGTTGG + Intergenic
1120031267 14:79643970-79643992 CTAAAGATATAAAGATAAATAGG - Intronic
1122801174 14:104230352-104230374 TCACAGACATGAAGGCAAAGGGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1124850438 15:33332951-33332973 CAATAAATATGAAAGTAAATGGG + Intronic
1129062040 15:72867866-72867888 CCAGAGATCAGGAGGTAAATGGG - Intergenic
1132158559 15:99514864-99514886 TCACAGAAATGAAAGTAGATTGG - Intergenic
1133109302 16:3536305-3536327 CCTCAGACTTGTAGGTAAATGGG + Exonic
1133134587 16:3701287-3701309 CAACATATATGAAGTTAAAACGG + Intronic
1134389397 16:13805374-13805396 CTACATATAAAAAGGTAAATTGG + Intergenic
1135660191 16:24289673-24289695 CCACAGCTAGGAAGGCAAATGGG - Intronic
1137964101 16:52913999-52914021 CCACAGATCTGAGTGAAAATAGG + Intergenic
1138952876 16:61934706-61934728 CCAGAGATACAAAGGTGAATGGG - Intronic
1140183562 16:72745789-72745811 CCACATATAAGAAGGGAAGTGGG + Intergenic
1141365061 16:83435015-83435037 ACACATATATGAAGGAACATAGG + Intronic
1142876649 17:2855068-2855090 CCACAGGTATGAACGTACCTGGG + Intronic
1143113834 17:4569575-4569597 CCACTGAAATGATTGTAAATTGG + Intergenic
1149512795 17:57256735-57256757 GCTCAGATATGGAGGCAAATGGG + Exonic
1152022064 17:77785160-77785182 TCACAGATATTAAGGAAATTGGG + Intergenic
1153598749 18:6757291-6757313 GCAGAGATATGTAGGAAAATAGG + Intronic
1155719336 18:28991617-28991639 CTACAGAAATGAAGAAAAATAGG - Intergenic
1156004168 18:32420386-32420408 CCACTGATATTGAGGGAAATGGG + Intronic
1156776877 18:40801196-40801218 ACACATATATGAAGATAAAATGG - Intergenic
1157224920 18:45854012-45854034 CCAAAGAAATGAAGGCAAAGAGG + Intronic
1159411660 18:68084544-68084566 CCAAAGAAAGGAAGGAAAATTGG + Intergenic
1159824048 18:73183839-73183861 CCACTGATAAGAATGTAGATTGG + Intronic
1165892179 19:39119956-39119978 CAAAAGATATGTAGGTAAAGTGG + Intergenic
925314135 2:2908277-2908299 CCACAGATATGAAGGAAGCATGG + Intergenic
925884521 2:8383119-8383141 CCAGAGATACAAAGGTGAATAGG + Intergenic
926439942 2:12877486-12877508 CCACTGGTATGAATGTAAAATGG + Intergenic
927049910 2:19317149-19317171 CAACAAAAATGAAGATAAATTGG - Intergenic
928037933 2:27843596-27843618 CCATAGAGATGAATATAAATAGG + Intronic
928753781 2:34500152-34500174 CCACAGAGAAGATGGGAAATTGG + Intergenic
929951180 2:46410659-46410681 ATACAGATGTGAAGGTATATAGG + Intergenic
930535550 2:52641865-52641887 TCACAGATATTAAGCTATATAGG + Intergenic
931875998 2:66513382-66513404 GCCCAGGTATGAAGGTAAACAGG - Intronic
933060025 2:77725472-77725494 CCAATGATATGACAGTAAATGGG - Intergenic
933342946 2:81046202-81046224 CCACAGATAACAAGAGAAATGGG - Intergenic
933517138 2:83319170-83319192 CCAAATATATGATAGTAAATTGG + Intergenic
935305809 2:101735329-101735351 GTACAGAGATGAAGATAAATAGG - Intronic
936466510 2:112756450-112756472 TCAAAGATATAAAGGTTAATAGG - Exonic
938585521 2:132686524-132686546 CAAGAGATGTGAAGATAAATAGG - Intronic
938887754 2:135670612-135670634 CCACATATAAAAATGTAAATGGG + Intronic
939484877 2:142798445-142798467 CAACAGATTTGAAGGCAAAGTGG + Intergenic
943988027 2:194647720-194647742 TCAAAGATATGATGGAAAATTGG - Intergenic
945377074 2:209091377-209091399 CCACAGATATGAATGTCACTTGG + Intergenic
945785372 2:214228483-214228505 CCAAAGATATGAAAATAATTTGG - Intronic
946112918 2:217436134-217436156 CCTGAGACATGAAGGCAAATAGG - Intronic
946279686 2:218657965-218657987 CCACAGATATGGAGCTGCATTGG + Intronic
948186480 2:236025503-236025525 CCACACAGAAGAAGGGAAATTGG + Intronic
948769011 2:240238209-240238231 CCAAAGATCTGTAGGAAAATAGG - Intergenic
1169753414 20:9018978-9019000 ACAAAGATATGAAGGGAAAATGG + Intergenic
1173176029 20:40765589-40765611 CCACTGATCTGAAGATAAAGGGG + Intergenic
1175220451 20:57413784-57413806 CCACTGGTGTGAAGGTAAAGAGG - Intergenic
1175901382 20:62361211-62361233 CCAGTGAGATGAAGGTAAACAGG + Intronic
1179162248 21:38908239-38908261 CCATAGATAAGAAGATAAGTGGG - Intergenic
1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG + Intergenic
949288631 3:2436867-2436889 AAATAGATATGGAGGTAAATTGG + Intronic
950017826 3:9766824-9766846 CCACAGCTTGGAGGGTAAATTGG - Intronic
950271380 3:11618576-11618598 CCACAGATTTTAATGTTAATGGG + Intronic
950366193 3:12485833-12485855 CCACAGATATGAAAGAAGAGCGG - Intronic
952461323 3:33529529-33529551 CCTCAAATATGAATGTAAAATGG - Intronic
953225524 3:41015830-41015852 GGGCAGAAATGAAGGTAAATTGG + Intergenic
953303116 3:41798968-41798990 GGACAGATGTGCAGGTAAATAGG + Intronic
954795219 3:53157981-53158003 CCACACAGCTGAAGGCAAATGGG - Intronic
956002992 3:64748862-64748884 TTACAGACTTGAAGGTAAATTGG - Intergenic
956701978 3:71966630-71966652 CCTAAGATATGAAGACAAATGGG - Intergenic
957572110 3:81960295-81960317 CCACAGAGATTAAGGTAGTTAGG - Intergenic
959878568 3:111416196-111416218 TCACAGAAATAAAGGAAAATAGG + Intronic
959936013 3:112029515-112029537 CAACAGATCTGGTGGTAAATGGG - Intergenic
964657399 3:159082973-159082995 CCACAGACTTGAATGTAAAATGG + Intronic
965819704 3:172672904-172672926 CCCCAGATATGGAGGTCACTGGG + Intronic
965920481 3:173907448-173907470 CTACAGAAATGTAGGGAAATAGG - Intronic
966566535 3:181388574-181388596 CTACTGATAGGAATGTAAATTGG - Intergenic
969779732 4:9390248-9390270 ACATAGATATGTAGGTATATAGG + Intergenic
971614663 4:28772781-28772803 AAACAGATATGAAGGGAACTTGG - Intergenic
971709989 4:30098202-30098224 CCACATATGCGAAAGTAAATGGG - Intergenic
972582829 4:40410139-40410161 CCACTGATGGGAAGGTAAAATGG + Intergenic
975201143 4:71591142-71591164 CTACAGATATGAAGAGAAGTGGG - Intergenic
977402506 4:96550455-96550477 CTACAGCTATGAAAGTTAATCGG + Intergenic
978256201 4:106695664-106695686 CCACAGACAAGGAAGTAAATCGG - Intergenic
979637100 4:122968763-122968785 CAACAGGTAGAAAGGTAAATTGG - Intronic
981881758 4:149621937-149621959 ATACATATATGAAGGAAAATTGG - Intergenic
983915793 4:173289207-173289229 CCTCAGAAATGAAAGTAAAAGGG + Intronic
983927859 4:173421097-173421119 CCACAGATATGGAGGTATAAAGG + Intergenic
984187414 4:176562768-176562790 CAACAGATAAAAAGTTAAATAGG + Intergenic
986834160 5:11616403-11616425 CTGCAGATGTGAAAGTAAATAGG - Intronic
987018392 5:13844667-13844689 ACACAGTTCTGAAGGTAAATTGG + Intronic
987588744 5:19894700-19894722 AAACAGCTATGAAGATAAATGGG - Intronic
988596990 5:32604100-32604122 TCACAAACCTGAAGGTAAATGGG + Intergenic
990237694 5:53785213-53785235 AGACATATATGCAGGTAAATGGG - Intergenic
991487273 5:67150571-67150593 GCACAGATGGGAAGGTAAGTTGG + Intronic
991594890 5:68293366-68293388 CCACAGAACTGAAGGTTAATGGG - Exonic
993612482 5:90072217-90072239 CAAATGATATGAGGGTAAATTGG + Intergenic
995104592 5:108360981-108361003 CCAAAGAAATGAAGGAAATTAGG - Intronic
995450762 5:112297647-112297669 CAACAAAAATGAAGATAAATAGG - Intronic
996102017 5:119453650-119453672 ATACAGATATGAAAGTACATAGG - Intronic
997539546 5:134649962-134649984 CCAAAGATTTGTAAGTAAATTGG - Intronic
999962279 5:156768554-156768576 TCCCAGATAGGTAGGTAAATGGG - Intergenic
1003015976 6:2467906-2467928 CCACAGAAATGAAGACAATTAGG - Intergenic
1011247931 6:85339499-85339521 GCACAGAAGTGAAGGGAAATAGG + Intergenic
1012541058 6:100362332-100362354 TCACAGATATGAATGAAAAAAGG + Intergenic
1017985728 6:159441768-159441790 CCACAGAACTGCAAGTAAATGGG - Intergenic
1020409113 7:7871005-7871027 AAACAGACATGAAGGTAAGTGGG - Intronic
1022751302 7:33229172-33229194 CCACAGAAATGAAAGAAAAATGG - Intronic
1026226254 7:68444132-68444154 AGACAGATATGTAGGTAGATAGG + Intergenic
1028717331 7:93986495-93986517 CCACAGATACTAAGCTAACTAGG + Intronic
1029958661 7:104667092-104667114 CTACTGGTATGAATGTAAATTGG - Intronic
1030740922 7:113109068-113109090 CAACAGATATGGGGGTGAATGGG + Intergenic
1031313137 7:120224696-120224718 CCAGAGATATGAAGGACAGTTGG - Intergenic
1031792506 7:126125566-126125588 CCACAGATACACAGATAAATAGG - Intergenic
1032073275 7:128822979-128823001 CCACAGGAATGAAGGTAAACAGG - Intergenic
1036344174 8:7946163-7946185 ACATAGATATGTAGGTATATAGG - Intronic
1036839517 8:12106934-12106956 ACATAGATATGTAGGTATATAGG - Intronic
1036861307 8:12353175-12353197 ACATAGATATGTAGGTATATAGG - Intergenic
1037642093 8:20754521-20754543 CTACAGCTATAAAGGTAAAACGG - Intergenic
1038229554 8:25687614-25687636 CCACAGGAATGAGGGTAAACTGG - Intergenic
1038751588 8:30301032-30301054 ACAAAGATATGAAAGTAAACTGG + Intergenic
1040552500 8:48449423-48449445 CCACATTTATCAAGTTAAATTGG + Intergenic
1040606366 8:48936098-48936120 CCACAAAAATAATGGTAAATAGG - Intergenic
1040631040 8:49210756-49210778 CCACAGATAAGAATGAAAATAGG - Intergenic
1044201013 8:89436847-89436869 CCTAACATATGAAGGTAAATAGG + Intergenic
1045602674 8:103735095-103735117 CCACAGATGTGAGGAGAAATAGG - Intronic
1045609524 8:103820381-103820403 CCACATATATTTAGTTAAATGGG - Intronic
1048034732 8:130666647-130666669 CTTCAGATATTAAGGTAAAGGGG + Intergenic
1048571178 8:135658131-135658153 CCACTGCTATGAAGGTAAGAAGG + Intergenic
1050665951 9:7936740-7936762 CCAGAGAGATGAAGGTGAAATGG + Intergenic
1052467346 9:28846145-28846167 CCTCAGAGATGAATGTATATAGG + Intergenic
1053289774 9:36872279-36872301 CCCCAGATCTGAAGGGAACTTGG + Intronic
1057238336 9:93385363-93385385 TCACAGATATGAAGCTATTTAGG - Intergenic
1186530233 X:10287640-10287662 CCACAGACATGCAGGGAAAGGGG + Intergenic
1188994049 X:36860437-36860459 CCACTGATCTCAAGGTGAATAGG - Intergenic
1189877322 X:45449606-45449628 CCAGAGAAATCAAGGTAAAGAGG - Intergenic
1192668605 X:73115282-73115304 ACACAGATATGAAGACAATTCGG - Intergenic
1193250450 X:79284737-79284759 CTACTGGTATGAATGTAAATTGG - Intergenic
1193469901 X:81887545-81887567 ACACAGATCTTAAGGGAAATTGG + Intergenic
1198749044 X:139920484-139920506 CCAGAGATAAGAAAGTAGATGGG + Intronic