ID: 1088766884

View in Genome Browser
Species Human (GRCh38)
Location 11:112990501-112990523
Sequence GAGGTCAGCAACCCTGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088766877_1088766884 14 Left 1088766877 11:112990464-112990486 CCAGTCTCAGAGCCATTTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1088766884 11:112990501-112990523 GAGGTCAGCAACCCTGCTCCGGG 0: 1
1: 0
2: 4
3: 23
4: 180
1088766881_1088766884 2 Left 1088766881 11:112990476-112990498 CCATTTCAGGGTTTTTTGTGGGA 0: 1
1: 0
2: 3
3: 23
4: 264
Right 1088766884 11:112990501-112990523 GAGGTCAGCAACCCTGCTCCGGG 0: 1
1: 0
2: 4
3: 23
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088766884 Original CRISPR GAGGTCAGCAACCCTGCTCC GGG Intronic
900187319 1:1338469-1338491 GAGGCAAGCAGCCCTGCCCCTGG + Intronic
902329244 1:15723002-15723024 GAGCTCAGGAATCCTGCTCCAGG - Intronic
903438120 1:23367984-23368006 GATGGCAGCCACCCTGCTCATGG - Exonic
903502667 1:23810085-23810107 GAGAGCAGCTGCCCTGCTCCAGG - Intronic
904120340 1:28193994-28194016 GAGGCCAGGAAGCCAGCTCCTGG + Intergenic
904210351 1:28883174-28883196 TGGGTCAGCAACCCTTCTCCAGG - Intergenic
906513266 1:46423590-46423612 GAGGTCAGCTGCCCAGCTGCAGG + Intergenic
907832132 1:58074909-58074931 GGAGTCTGCATCCCTGCTCCCGG - Intronic
908065106 1:60394514-60394536 GAGATTAGAAACCATGCTCCTGG + Intergenic
911747191 1:101452908-101452930 GAGGTCTGCATCTCTTCTCCCGG - Intergenic
912591497 1:110825038-110825060 GTGGTCAGCAACCCTGTGCAGGG + Intergenic
912743030 1:112219380-112219402 CAGGTCAGCAACCCAACCCCAGG - Intergenic
913330265 1:117661438-117661460 GGGTTTTGCAACCCTGCTCCTGG - Intergenic
913444261 1:118933109-118933131 CAGGTCTGCAAACCTGCTGCAGG - Intronic
915571101 1:156745423-156745445 GAGGTCAGCACCCCTGCCTCAGG - Intronic
915740921 1:158117911-158117933 GAGGAGACCAACCCCGCTCCTGG - Intergenic
916084602 1:161259230-161259252 GAGCTCAGCATCCCCGCTTCCGG - Intronic
918700772 1:187603889-187603911 GAGGTCAGCATTCCTTCCCCCGG - Intergenic
919074755 1:192799358-192799380 GAGGTTTGCACCCCTGCACCTGG - Intergenic
921830849 1:219725594-219725616 CAGCTCAGCAAGCCTACTCCTGG + Intronic
1065299741 10:24310637-24310659 GAGTTCAGGGACCTTGCTCCAGG + Intronic
1065961610 10:30738442-30738464 GAGGTTAGAAAACCTGCTCAAGG - Intergenic
1067478302 10:46580059-46580081 TAGGGCAGCAACCCTGCCTCTGG - Intronic
1067616437 10:47761728-47761750 TAGGGCAGCAACCCTGCCTCTGG + Intergenic
1067748177 10:48952256-48952278 GAGGCAAGCAACCCACCTCCTGG + Intronic
1068977279 10:63023429-63023451 CAGGTCAGCAAGCCTGCAGCTGG - Intergenic
1070279449 10:75038021-75038043 CCGGTCAGCCACCCTGGTCCTGG - Exonic
1070645027 10:78195806-78195828 CAGGTCAGCAACCCTCCTACTGG + Intergenic
1071353123 10:84766685-84766707 AAGGTCTGCAACCATGCTACTGG - Intergenic
1074284780 10:112088052-112088074 GAGGTCAGCAAACCTGCTGTGGG - Intergenic
1076820785 10:132938510-132938532 GAGGCCACCACCCCTTCTCCGGG - Intronic
1077091166 11:778959-778981 GGGGTCAGGGACCCTTCTCCAGG - Intronic
1077174583 11:1182910-1182932 GATGGCAGCTACCCTGCTCCTGG + Intronic
1077174798 11:1184029-1184051 GATGGCAGCTACCCTGCTCCTGG + Intronic
1077486668 11:2841887-2841909 GAGGGAGGCAACCCCGCTCCTGG + Intronic
1080737503 11:35031142-35031164 GAGCTTGGCAACCCTGCTTCAGG + Intergenic
1082112398 11:48291894-48291916 CAGGTCAGAAACCCTGTACCAGG - Intergenic
1082323090 11:51101686-51101708 GAGGTGAACAATCCTGCTCATGG + Intergenic
1082360771 11:51648869-51648891 GAGGTCAACAATCCTGCTGATGG + Intergenic
1082432426 11:52687920-52687942 GAGGTGAGCAATCCTGCTGATGG + Intergenic
1082437847 11:52766123-52766145 GAGGTGAGCAATCCTGCTGATGG + Intergenic
1082442035 11:52826462-52826484 GAGGTGAACAATCCTGCTGCTGG + Intergenic
1082444166 11:52857049-52857071 GAGGTCAACAATCCTGCTGATGG + Intergenic
1082463487 11:53137579-53137601 GAGGTCAACAATCCTGCTGATGG + Intergenic
1082491465 11:53540352-53540374 GAGGTGAACAATCCTGCTCATGG + Intergenic
1082497500 11:53627925-53627947 GAGGTGAACAATCCTGCTGCTGG + Intergenic
1082545068 11:54316594-54316616 GAGGTGAACAACCCTGCTGATGG + Intergenic
1082546067 11:54331047-54331069 GAGGTGAACAATCCTGCTCATGG + Intergenic
1084689387 11:70716238-70716260 GAGGTGCTCAACACTGCTCCCGG + Intronic
1088766884 11:112990501-112990523 GAGGTCAGCAACCCTGCTCCGGG + Intronic
1089508355 11:118979741-118979763 CAGGTCAGCAACCCAGGGCCTGG - Intronic
1090086443 11:123654553-123654575 GTGATCAGCAACCCTTCTCTAGG + Exonic
1090945520 11:131426290-131426312 GAGGACAGAAATCCTGCTCCAGG + Intronic
1091624419 12:2111362-2111384 GAGGGGAGCATCCCTGCACCCGG - Intronic
1097499983 12:60389715-60389737 GAGGTCAGGAACCCTGTACAGGG + Intergenic
1099082640 12:78204997-78205019 GAGCTCAGCAACTCTGCCTCAGG + Exonic
1100433928 12:94554464-94554486 GAGCTCGGCCACCCTGCTCTAGG - Intergenic
1101444302 12:104726606-104726628 AAGCTCAACAACCCTGCTTCAGG + Intronic
1102097717 12:110253422-110253444 GACGTCAGCAGCCCGGCTGCTGG - Intergenic
1104571242 12:129927771-129927793 GAGGCCATCAAACCTTCTCCTGG + Intergenic
1104760348 12:131294237-131294259 GGGGTCAGCAACCCACCTGCTGG - Intergenic
1105305495 13:19165964-19165986 GAGGTCAGAAACTCTGCTCCAGG - Intergenic
1105778496 13:23685120-23685142 CAGGTCAGAAACCCTGCACAGGG - Intergenic
1107003339 13:35577294-35577316 GAGGTCAGCTCACCTGCACCAGG + Intronic
1107311699 13:39085464-39085486 CAGGTCAGAAACCCTGCACGGGG - Intergenic
1110990837 13:82040319-82040341 GAGGTCAGGAACCCTACACAGGG + Intergenic
1112825767 13:103391000-103391022 GAGGCCAGCAACCTTGGTTCTGG - Intergenic
1119303928 14:73591959-73591981 GATGTCAGCAACGCTGATCCTGG + Exonic
1121438479 14:93934100-93934122 GAGGTCCTCAGCCTTGCTCCTGG - Intergenic
1122295302 14:100702132-100702154 AAGGTCAGAAGCCCTGCCCCAGG - Intergenic
1125056220 15:35360874-35360896 GAGGTCAGCAGGCCTGCCACTGG + Intronic
1130222535 15:82032626-82032648 GAGATCATGAACTCTGCTCCAGG + Intergenic
1130999548 15:88928654-88928676 CAGGTCAGGAACCCTGCACAGGG - Intergenic
1131068704 15:89450488-89450510 GAGGGCTGCAAGCCTGCTCCAGG - Intergenic
1132352421 15:101148328-101148350 GAGGTCAAGAAACCTGCTCCAGG - Intergenic
1137561247 16:49503577-49503599 GCGGACAGGAAGCCTGCTCCAGG - Intronic
1137625927 16:49908554-49908576 AAGCTCAGCAACCCTGCCTCTGG - Intergenic
1138701717 16:58870165-58870187 GAGTCCAGCAACCCTTCTCGAGG + Intergenic
1141161664 16:81633267-81633289 CAGATCAGCAACCCAGCTCAGGG - Intronic
1142616659 17:1140403-1140425 GAGGCCGGCAACCCTGAACCAGG + Intronic
1143186468 17:5013345-5013367 CAGGTCAGCAACCCTTCCCAAGG - Intronic
1146359164 17:32159902-32159924 GGGATCAGCAACCCAGCCCCCGG - Intronic
1147054082 17:37820849-37820871 GATGTCACCAAAGCTGCTCCAGG + Intergenic
1148767782 17:50049312-50049334 AAGGTCAGGATCCCTACTCCAGG + Intergenic
1149988142 17:61364003-61364025 GAGGACAGCAAAGGTGCTCCTGG - Intronic
1150490825 17:65573224-65573246 GAGGGCAGAGACCCTGCTCTTGG - Intronic
1152018228 17:77766026-77766048 GGGGTGGGGAACCCTGCTCCAGG - Intergenic
1152286872 17:79417698-79417720 ATGGTCAGCAACCCTGCTCCTGG + Intronic
1152364972 17:79850234-79850256 CAGCTCAGAAAGCCTGCTCCAGG - Intergenic
1152487581 17:80604507-80604529 ATCGTCAGCAACCCTGCTCCTGG - Intronic
1152727364 17:81954236-81954258 GAGGTCAGTGTCCCTGCTCCGGG - Exonic
1153892993 18:9535458-9535480 GAGGCTGGAAACCCTGCTCCTGG - Intronic
1154492785 18:14934139-14934161 GGAGTCAGCAGACCTGCTCCAGG - Intergenic
1155799408 18:30081891-30081913 GGGGGCAGCGACCCTGCTGCTGG + Intergenic
1160806267 19:993533-993555 GAGGTCGGGAACCCGCCTCCTGG - Intronic
1161012521 19:1967537-1967559 GAGGCCAAGAACCCTGCACCGGG - Intronic
1161320152 19:3637372-3637394 GAGGTCAGCCACGCTGGCCCCGG - Intronic
1163237247 19:16037020-16037042 GAGCTCAGCATCCCTGTTCAAGG + Intergenic
1165533233 19:36421536-36421558 GATGTCAGCAACGCTGATCCTGG + Intergenic
1166718171 19:44982436-44982458 GTGGCCAGCAACCCTGATACTGG + Intronic
925052454 2:827545-827567 CAGGTCAGGAACCCTGCACAGGG - Intergenic
926276198 2:11404990-11405012 GAGGACAGCAGCCCTGCTGGGGG + Intergenic
928084465 2:28337199-28337221 GAGGTGGGCACCCGTGCTCCTGG - Intronic
929576876 2:43057521-43057543 GAGGTGAGCAACCAGGCTGCTGG - Intergenic
931221926 2:60295997-60296019 GAGGGCTGAAGCCCTGCTCCTGG - Intergenic
935189856 2:100768433-100768455 GAGGCCAATAACCCTGCACCTGG + Intergenic
935237755 2:101152219-101152241 GAGGTCCTCCAGCCTGCTCCAGG - Intronic
937250298 2:120519517-120519539 GCGGTCAGAAAGGCTGCTCCAGG - Intergenic
937579915 2:123472710-123472732 CAGGTCAGGAACCCTGTTCAGGG - Intergenic
938294234 2:130167457-130167479 GAGGTCAGAAACTCTGCTCCAGG - Exonic
940382826 2:153035630-153035652 CAAGCCAGCAACCCTACTCCTGG + Intergenic
947999855 2:234558908-234558930 GTGGTTAGGAACCCAGCTCCTGG - Intergenic
948008819 2:234634194-234634216 GAGGGCAGAATCCCTACTCCTGG - Intergenic
948099087 2:235359457-235359479 GATGCCAGCAGCCCTCCTCCTGG + Intergenic
948853832 2:240721008-240721030 GATGTCTGTCACCCTGCTCCGGG - Exonic
949029099 2:241780862-241780884 CAGGTCAGGAACCCTGTTCGGGG + Intronic
1169116147 20:3067280-3067302 GAGTTCAGTCACTCTGCTCCAGG + Intergenic
1173291326 20:41717572-41717594 TAGGACAGCAACCCTGCTGAAGG + Intergenic
1173906637 20:46634488-46634510 AAGGGCAGCAAACCTGCCCCAGG + Intronic
1175722225 20:61294258-61294280 CAGGTCAGCAGCCCTGGCCCCGG - Intronic
1175927612 20:62478711-62478733 GAGGTGAGCTAACCTGCCCCAGG + Intergenic
1177157225 21:17512567-17512589 GAGGTCAGAGAACCTGCCCCTGG + Exonic
1179119603 21:38530500-38530522 GAGGCCAGAAAGCCTTCTCCAGG + Intronic
1179162131 21:38907332-38907354 CACGTCAGCAGCCCTGCTCCAGG + Intergenic
1180874221 22:19167355-19167377 GAGGTCAGGAACCCAGATCAGGG + Intergenic
1181113497 22:20616309-20616331 GAGGTCAGAAACTCTGCTCCGGG - Intergenic
1182522925 22:30894504-30894526 GAGGCCAGGGAGCCTGCTCCAGG - Intronic
1183079244 22:35445959-35445981 GAGGTCAGCAACACTGCATCTGG + Intergenic
1184848184 22:47101905-47101927 GTGCTCAGCTACCCTGCACCAGG - Intronic
1184890634 22:47376887-47376909 GAGGGCAGCATCCCTGCCCCCGG + Intergenic
1185331898 22:50255702-50255724 GAGGTCAGGAACACAGCTCGGGG + Intronic
950953772 3:17029220-17029242 GATCTCAGCATCCCAGCTCCTGG + Intronic
952752452 3:36836218-36836240 TAGGCCAGCAAGCCTGCTCCTGG + Intronic
954590373 3:51777505-51777527 GAGGTCTGCAACCCTCCGCAGGG - Intergenic
954634766 3:52065457-52065479 CAAGCCAGCAACCCTGCACCTGG - Intergenic
955794376 3:62620599-62620621 GAAGTCAGAGATCCTGCTCCAGG + Intronic
956129566 3:66040154-66040176 GAGGTCACCAAGCTTGCTCAAGG - Intergenic
962658319 3:137572383-137572405 GAGGATAGGAACCCTTCTCCAGG - Intergenic
963274183 3:143314011-143314033 GAGTTCAGCAACCCTCCTCTGGG + Intronic
965588158 3:170337333-170337355 CAGGTCAGAAACCCTGCACAGGG + Intergenic
968065159 3:195754372-195754394 GTGATCGGCAACCCTCCTCCAGG - Exonic
968578416 4:1378589-1378611 GAGGGAAGCATCCCTGCACCTGG + Intronic
969703973 4:8782231-8782253 GAGGCCAGCAACCGTGCCCCTGG + Intergenic
972322109 4:37981616-37981638 GAGGGCAGGAAACATGCTCCAGG + Intronic
975990372 4:80253624-80253646 GAGGTCAAGAAACTTGCTCCAGG + Intergenic
976806190 4:89050275-89050297 GATCTCTGCAACCCTGCCCCTGG + Intronic
978538948 4:109795160-109795182 AAAGAGAGCAACCCTGCTCCTGG + Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
985010933 4:185581303-185581325 GAGGTCAGAAGCCCTGCCCTAGG - Intergenic
985749346 5:1665494-1665516 GAGGCCAGACAGCCTGCTCCTGG - Intergenic
986754164 5:10819056-10819078 AAGTTGAGAAACCCTGCTCCAGG + Intergenic
987233829 5:15923074-15923096 GAATTCTGCAACCCTCCTCCTGG - Intronic
988295411 5:29353915-29353937 GAGGTCAAGAACCCTGCACAAGG - Intergenic
998216346 5:140240891-140240913 GAGGACAGAATCTCTGCTCCTGG - Intronic
999104920 5:149062707-149062729 GAGCTGAGCAGCACTGCTCCTGG - Intronic
999115214 5:149156898-149156920 GGGGTCAGCAAACCGGCTCACGG - Intronic
999275615 5:150328049-150328071 CATGACAGCAACCCTGCTTCTGG + Intronic
999335193 5:150709947-150709969 AAGGTTAGCAACCCAACTCCAGG + Intronic
1000232066 5:159325240-159325262 GAGCTCAGGAACCTTGGTCCTGG - Intronic
1000249596 5:159481471-159481493 TAGGTCAACAAACCTGCACCAGG + Intergenic
1001701201 5:173707685-173707707 CAGGCCAGCCACCCTGCCCCAGG - Intergenic
1001763146 5:174223895-174223917 GAGGTCACTAATCCAGCTCCAGG - Intronic
1004742263 6:18473440-18473462 GAGATCAGCAATTCTGCTTCTGG + Intergenic
1006317165 6:33297860-33297882 GAGGCCCGAAATCCTGCTCCTGG + Intronic
1006453794 6:34120684-34120706 GAGGTTGGCTATCCTGCTCCTGG - Intronic
1007171596 6:39867956-39867978 GTGGTCTGCATGCCTGCTCCTGG + Intronic
1007696537 6:43737442-43737464 TGGGCCAGCAGCCCTGCTCCAGG + Intergenic
1011259230 6:85454212-85454234 GTGGCCAGCAATTCTGCTCCTGG - Intronic
1018047151 6:159975436-159975458 GAGGTCAGCATTTCTTCTCCCGG + Intronic
1018061239 6:160091456-160091478 TGGGTCAGCATCGCTGCTCCTGG + Intronic
1018150527 6:160933123-160933145 GAGGTCAGGATCCATGCTGCTGG + Intergenic
1018817289 6:167343096-167343118 GAGGTTGGCAAGCCTACTCCAGG + Intronic
1019494023 7:1329254-1329276 GTGGACAGCAGCTCTGCTCCTGG - Intergenic
1020079754 7:5281213-5281235 GGGGTCAGCACCTTTGCTCCAGG - Intronic
1021821800 7:24506008-24506030 GAGGTCTCCATCCATGCTCCAGG + Intergenic
1024436060 7:49356072-49356094 AAGGTCACCAACCATGGTCCTGG - Intergenic
1025199154 7:56950990-56951012 GGGGTCAGCACCTTTGCTCCAGG + Intergenic
1025672793 7:63625943-63625965 GGGGTCAGCACCTTTGCTCCAGG - Intergenic
1026023098 7:66725997-66726019 GAGGTCAGCAGCCATGGGCCTGG + Intronic
1030156061 7:106456965-106456987 CAGGTCAGCAACCCTGTACAGGG + Intergenic
1030304032 7:108002089-108002111 GGGGTCAGCCTCCCTGCGCCGGG - Intronic
1034823842 7:154242227-154242249 GAAGTCAACAGACCTGCTCCAGG - Intronic
1035379609 7:158429383-158429405 GAGCTCAGCATCCCTTCTCCAGG + Intronic
1036826136 8:11977542-11977564 GAGCACAGCAATCCTGCTGCTGG + Intergenic
1037094501 8:14967880-14967902 GAGGTGAACAGCCCTACTCCAGG + Intronic
1042666859 8:71216443-71216465 GAGGTCAGGAAACTTGCCCCAGG + Intronic
1047716528 8:127600663-127600685 GAGGTTAAGAACCTTGCTCCTGG - Intergenic
1049225356 8:141448132-141448154 TAGGTCAGAACCCCTGGTCCCGG - Intergenic
1049255720 8:141612565-141612587 CAGGACAGCCTCCCTGCTCCTGG + Intergenic
1049400830 8:142426503-142426525 GAGGTCAGGAATCCAGCTCTGGG + Intergenic
1049435231 8:142583421-142583443 GGGGGCAGCAGGCCTGCTCCTGG - Intergenic
1055962224 9:81831472-81831494 CAGGTGAGCAGCCCTTCTCCTGG + Intergenic
1056727621 9:89135263-89135285 CAGGTCAGGAACCCTGCACAGGG - Intronic
1058893355 9:109379961-109379983 GGGGTCAGGGAGCCTGCTCCTGG + Intronic
1059595639 9:115717376-115717398 GAGGTTAGAAATCTTGCTCCTGG - Intergenic
1059747921 9:117220694-117220716 GATGTCAGCAAGCCTCCTCCCGG - Intronic
1061760371 9:132847070-132847092 GTGGTCAGCAGGCCAGCTCCCGG + Intronic
1062261593 9:135665750-135665772 AAGGTCAGCCCCACTGCTCCCGG + Exonic
1203740187 Un_GL000216v2:171532-171554 CAGGTGAGCACCCCGGCTCCTGG - Intergenic
1186321128 X:8426549-8426571 GAGTTCAGAAAGGCTGCTCCAGG - Intergenic
1192227375 X:69238552-69238574 GAGGTTAGGAACCCTGCGCCAGG - Intergenic
1192631977 X:72784308-72784330 GACGTCAGAAACCCTGGACCAGG - Intronic
1192649732 X:72936493-72936515 GACGTCAGAAACCCTGGACCAGG + Intronic
1195877209 X:109554472-109554494 CAGGTCAGGAACCCTGCACAGGG - Intergenic
1195917729 X:109952330-109952352 AAGGGCACCAGCCCTGCTCCAGG - Intergenic
1199948304 X:152684796-152684818 CAGGTCAGTAACCCTGCACAGGG - Intergenic
1199961375 X:152783658-152783680 CAGGTCAGTAACCCTGCACAGGG + Intergenic
1200232192 X:154449627-154449649 GAGGACAGCACCCCTGCCCAGGG - Intronic