ID: 1088767634

View in Genome Browser
Species Human (GRCh38)
Location 11:112999237-112999259
Sequence TTTTCCACTTAGAGGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088767634_1088767636 3 Left 1088767634 11:112999237-112999259 CCTTCACTCCTCTAAGTGGAAAA 0: 1
1: 0
2: 2
3: 19
4: 215
Right 1088767636 11:112999263-112999285 ATTGCTAAAAATAAAACTTAAGG 0: 1
1: 0
2: 6
3: 76
4: 708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088767634 Original CRISPR TTTTCCACTTAGAGGAGTGA AGG (reversed) Intronic
903859408 1:26355932-26355954 TTCTTCCCTTGGAGGAGTGAGGG - Intergenic
911211499 1:95143150-95143172 TTTGCCACTCAGAAAAGTGAGGG + Intronic
912389658 1:109293891-109293913 TTTTCTACTTTTAGTAGTGATGG - Intronic
912841502 1:113043272-113043294 TTTTGCATTTTTAGGAGTGACGG - Intergenic
913244367 1:116858844-116858866 TTTTCCACTACAAGGAATGATGG - Intergenic
916007684 1:160677252-160677274 TCTTCCACTGAGAAAAGTGAGGG + Intergenic
916571962 1:166035916-166035938 TTTTCCTTTAAGAGGATTGAAGG - Intergenic
919715100 1:200768236-200768258 TTTACCACATAGAGAAATGAAGG + Intronic
920962940 1:210680370-210680392 TTTTCCTCTTTGAGGAGTCGGGG - Exonic
921437655 1:215144634-215144656 TTTTCCACTTTGTGTAGTGATGG + Intronic
922007285 1:221544474-221544496 TTTTCCACTTTTAGTAGAGACGG - Intergenic
922940169 1:229456600-229456622 TTTTCCAGTAAAAGAAGTGAGGG - Intronic
923348056 1:233076609-233076631 TGTTACACTTTTAGGAGTGAAGG - Intronic
1063418976 10:5896111-5896133 TTGTGCACTTTGAGGAATGAGGG + Intronic
1063747310 10:8899268-8899290 TTTTTCACTTAGAGCAGTGGTGG - Intergenic
1068330030 10:55551908-55551930 TTTTACACTTAGACAAGTAAAGG - Intronic
1069392461 10:67950896-67950918 TTTTCCACTTAAAGAAGACACGG + Intronic
1071159498 10:82729101-82729123 TCTGCCACTTAGAAGGGTGATGG - Intronic
1075854900 10:125621511-125621533 TTTTCCACTTATATTAGTCAGGG + Intronic
1076628873 10:131840710-131840732 TTTTCCTGTTACAGGAGTGATGG - Intergenic
1077969439 11:7172748-7172770 TTTCCCACTTTGAGGAATAAAGG - Intergenic
1078319562 11:10322040-10322062 TTTTCCCCTTAGATTAGAGAAGG - Intronic
1079556579 11:21765611-21765633 TTTTCCACTTAGTGGATAAACGG - Intergenic
1080674483 11:34412195-34412217 TTTGCCACATGAAGGAGTGAAGG + Intergenic
1081652213 11:44832049-44832071 TTTTCCAGTTAGGGGAGTGATGG - Intronic
1082034043 11:47629797-47629819 TTTTCCTCATAGAAGAATGAGGG + Intronic
1085314745 11:75537834-75537856 CTTGCCACTTAGAGGAGTCAAGG + Intergenic
1087176602 11:95102071-95102093 TTTTCCTCTTAAAGGAGAGGAGG + Intronic
1088767634 11:112999237-112999259 TTTTCCACTTAGAGGAGTGAAGG - Intronic
1089865933 11:121631739-121631761 TTTTCCAAGGAGAGGGGTGATGG - Exonic
1091066584 11:132519244-132519266 TTTTCCACCTTGGGGAGGGAAGG + Intronic
1091604267 12:1936774-1936796 TCTTACAATTAGAGGAGTGAGGG - Intergenic
1093861439 12:24172024-24172046 CTTGCCACTTTGAGGAATGAGGG + Intergenic
1094379200 12:29824504-29824526 ATTTTTGCTTAGAGGAGTGAAGG - Intergenic
1095733542 12:45532288-45532310 TTTTTCTCTTTGAGGAATGAAGG - Intergenic
1096458868 12:51811047-51811069 CTTTTGGCTTAGAGGAGTGATGG - Exonic
1096924897 12:55133214-55133236 TTCTCCACTAAGAGCACTGATGG + Intergenic
1098101826 12:67025964-67025986 TTTTTGAGTTGGAGGAGTGAAGG + Intergenic
1099452723 12:82827271-82827293 TGTTCCACTTACATGAGAGAGGG - Intronic
1100040264 12:90308771-90308793 TTTTCCACTGACAAGAATGATGG - Intergenic
1103418883 12:120763813-120763835 TTTTTTTCTTAAAGGAGTGAGGG + Exonic
1105298447 13:19111814-19111836 TCTTCCATTTATGGGAGTGATGG - Intergenic
1106172350 13:27298860-27298882 TTTTCCACTTAGAGTAGGGTTGG + Intergenic
1108485616 13:50921047-50921069 TTTTCCACGTAGTTGAGGGAAGG + Intronic
1108993473 13:56694394-56694416 TATTCCACTTGCAGGAGGGAGGG + Intergenic
1110334174 13:74307492-74307514 TTCTCCACTGAGAGGAAGGAAGG + Intergenic
1110710904 13:78649755-78649777 TTTGGCACATACAGGAGTGAGGG + Intronic
1110890938 13:80697259-80697281 TTTTTCACAGAGAGCAGTGAAGG - Intergenic
1112356621 13:98678947-98678969 TTATCCTCTTAGTGGAGTCAGGG - Intergenic
1112537082 13:100269888-100269910 TTTTTCTCTTTGAGCAGTGAGGG + Intronic
1112930432 13:104729217-104729239 TTTTCCACTAAGTGTAGGGAAGG - Intergenic
1113631691 13:111892492-111892514 TGGTCCATTTTGAGGAGTGAGGG - Intergenic
1114073810 14:19139347-19139369 ATTTTCACTTAGAGGGGTAAGGG - Intergenic
1114088455 14:19260638-19260660 ATTTTCACTTAGAGGGGTAAGGG + Intergenic
1114875521 14:26712740-26712762 TTTAACACTTTGAGGATTGATGG - Intergenic
1115091035 14:29575807-29575829 CTTTCCACTTGGAGGAATGAGGG - Intergenic
1115665454 14:35540076-35540098 TTTTCAAGTTTGAGTAGTGAAGG - Intronic
1115877029 14:37872368-37872390 TTCTCCACTTTTAGGAGAGAAGG - Intronic
1119631815 14:76238535-76238557 TTTTCCACTTTCAGGGGTCAGGG + Intronic
1119901371 14:78262755-78262777 TTCTCAACTTAGAGGAGTAGTGG + Intronic
1120979017 14:90274552-90274574 TTCTCCACTAAAAGGAGTGAGGG + Exonic
1121284995 14:92728183-92728205 TTTTCCACACACAGGGGTGAGGG + Intronic
1121539793 14:94716935-94716957 TTTTCCACGGATGGGAGTGAGGG - Intergenic
1121672744 14:95725353-95725375 TCTTCTACTTGGAGGTGTGAAGG + Intergenic
1124229014 15:27926007-27926029 TTTTCCACTTAGAGAATATAAGG + Intronic
1125695282 15:41631640-41631662 CTTTCCACTTAAAGGGGTGGAGG + Intronic
1125952869 15:43768475-43768497 TTTTCCAATTGTAGGCGTGATGG + Exonic
1127773739 15:62250266-62250288 CTTTCCAGATGGAGGAGTGAGGG - Intergenic
1127899851 15:63333120-63333142 TTTTCCAGATGGAGGAGGGAGGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128719805 15:69940036-69940058 GTTTCCTCTTTGCGGAGTGAGGG + Intergenic
1129242063 15:74257679-74257701 CTTTCCACTTAGAGGAGAGAAGG - Intronic
1132225018 15:100133655-100133677 TCTTCCATTTACAGCAGTGAGGG + Intronic
1132238652 15:100240508-100240530 TCTTCCTGGTAGAGGAGTGAGGG - Intronic
1135641917 16:24127174-24127196 TTTTCCACTTTTAGTAGAGACGG + Intronic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1142145235 16:88490222-88490244 TTTTCTATTTTGAGGAGAGACGG + Intronic
1142313925 16:89331122-89331144 TTTTCTATTTTGAGGAGAGATGG + Intronic
1142491073 17:280134-280156 TTTGCCATTTTGAGGGGTGAAGG + Intronic
1142725806 17:1812852-1812874 ATTTCTATTTAGAGGACTGAAGG + Intronic
1142874670 17:2844383-2844405 TTTTCCCCTAAGAGTAGAGAGGG + Intronic
1149019736 17:51949526-51949548 ATTTCCACTTAGAGCTGTGTGGG + Intronic
1149205871 17:54247296-54247318 TTTTCCACGGACTGGAGTGATGG + Intergenic
1149804578 17:59603393-59603415 TCTGCCACTTAAAGGAGTCAGGG + Intronic
1157283954 18:46364539-46364561 TTTTCCAGTTAGAGGGGAGGTGG - Intronic
1160558103 18:79739231-79739253 TTTTCCACTAAGACCAGTCAGGG + Intronic
1163982654 19:20915601-20915623 TTTCCCACTGTGATGAGTGAGGG - Intergenic
1164151644 19:22558471-22558493 TTCTTCACTTAGAGAAATGAAGG + Intergenic
1168597950 19:57694270-57694292 ATTTCCAGTCAGAGGAGTAAAGG + Intronic
926102151 2:10125023-10125045 TTATTCACTTAGAGTTGTGAAGG + Intronic
926965014 2:18400315-18400337 TTTTGTACTTAGAGGTGTAATGG - Intergenic
928808665 2:35194879-35194901 TTTTCCACTGACAGGAGCAAGGG + Intergenic
933159954 2:79012859-79012881 TTTTCTACTTAGCGGACTCAGGG - Intergenic
934885304 2:98019408-98019430 TTTTCCACTTTTAGTAGAGACGG + Intergenic
935320459 2:101883097-101883119 TTCTCCACTTAGAGGTCTGGAGG + Intronic
937213807 2:120297377-120297399 TTCTCCACTTGGAAGGGTGAGGG + Intergenic
937525055 2:122758437-122758459 TTTTGCACTTGGAGTAGTGGTGG + Intergenic
939319095 2:140592768-140592790 TTTTTTACTTTGAGTAGTGATGG - Intronic
941009912 2:160287500-160287522 TTTTCTACTGGGAGAAGTGAAGG - Intronic
941150200 2:161905227-161905249 TTTTCCACAAAGAGGGTTGAGGG + Intronic
943156611 2:184187510-184187532 TTTTCCACATATGGGAGTGGGGG + Intergenic
943799010 2:192034405-192034427 TTTTCCCCATGGAGGAGTGATGG - Intronic
945327603 2:208501026-208501048 TTTTCCACTGACTGGAGTCAGGG + Intronic
947495768 2:230635403-230635425 TTTTCTATTTTGAGTAGTGATGG + Intergenic
947510350 2:230747265-230747287 TTTGACAAGTAGAGGAGTGAGGG + Intronic
947926996 2:233930089-233930111 TCTTCCACTTTGAGGAGTGTAGG + Intronic
948324995 2:237109411-237109433 TTTTCCACTAAAAGGAATTAGGG + Intergenic
1169986329 20:11449281-11449303 TTTGTCAATTTGAGGAGTGATGG + Intergenic
1170198800 20:13720044-13720066 TTTACCAGTTACAGGAGTCACGG - Intronic
1170702630 20:18716701-18716723 TTTTCCACTTAGTGGGGAGTTGG - Intronic
1171270502 20:23813304-23813326 TCTTCCACTAGGAGGACTGAGGG - Intergenic
1172322718 20:34009144-34009166 TTTTCCATTTATAAGAGTGGGGG + Intronic
1172995427 20:39066798-39066820 TTTTCCTTTTGGATGAGTGATGG + Intergenic
1173117440 20:40259022-40259044 TGTTCTACATAGAGGAGAGAAGG + Intergenic
1173132063 20:40403151-40403173 GATTCTACTTAGAGTAGTGAAGG - Intergenic
1173308779 20:41877127-41877149 TTCTCCCATTTGAGGAGTGAAGG - Intergenic
1173841448 20:46160002-46160024 TTTTCCACTTAATGTACTGATGG + Intergenic
1174124702 20:48295418-48295440 TTGTCAACGTAAAGGAGTGAAGG - Intergenic
1175321040 20:58088582-58088604 TTTTTCTGTTAAAGGAGTGATGG + Intergenic
1178183219 21:30188392-30188414 TTTGCCACTCAGGTGAGTGAAGG - Intergenic
1180492258 22:15861699-15861721 ATTTTCACTTAGAGGGGTAAGGG - Intergenic
1180923478 22:19535658-19535680 TTTTGCATTTTGAGTAGTGACGG + Intergenic
1182408306 22:30158152-30158174 ATTTCCACTGAGAGAATTGAGGG - Intronic
949281749 3:2354358-2354380 TTTTCCACTTTTAGTAGAGATGG - Intronic
950351359 3:12356981-12357003 TTTTCAGTTTAGAGGAGAGAGGG - Intronic
951393300 3:22133604-22133626 ATTTCTACTTAGAGGACTGGGGG + Intronic
952077971 3:29721554-29721576 TTTTCCCCTCAGAGGACTGTTGG - Intronic
952518538 3:34130668-34130690 ATTTCCACTTTAAGTAGTGATGG + Intergenic
956699130 3:71943337-71943359 TTTTCCACTAATAGGGGTGTGGG - Intergenic
956731130 3:72197704-72197726 TTGTCCACTCAGAGGAGCCAGGG + Intergenic
957902994 3:86521200-86521222 TTTTCCATTTAGAAGGGTTATGG - Intergenic
960979193 3:123205749-123205771 TTTTCCAGTTAGTGAAGTGGTGG + Intronic
961947901 3:130713332-130713354 TTTTCCACTCAGACAAATGAGGG + Intronic
961971256 3:130970828-130970850 GTTTCCACTTATATGAATGAAGG - Intronic
962324141 3:134419359-134419381 TGTTCCAAATAGAAGAGTGATGG + Intergenic
962894275 3:139699778-139699800 TTGTCCAGTTAGAGAAGTGAGGG + Intergenic
962905512 3:139797953-139797975 TTTTCCAGCTTGATGAGTGAGGG + Intergenic
963147296 3:142007513-142007535 TTTTCCACAGACAGGGGTGAAGG + Intronic
963419120 3:145037137-145037159 TTTTCCTTTTCGAGGAGAGATGG + Intergenic
964071383 3:152637797-152637819 GTTTCCATTCAGAGGTGTGATGG + Intergenic
964096892 3:152942375-152942397 TTGTCCACTATGAGGAGAGATGG - Intergenic
964233492 3:154497587-154497609 TTTCCAACTTAGAGGAGAGATGG - Intergenic
964929659 3:162001813-162001835 TTTCCCAATTAGAAGAGTGCTGG + Intergenic
965489850 3:169322562-169322584 GTTTCCTCTTTGAGGAGTGAAGG + Intronic
966243809 3:177783648-177783670 TTTTCCACTTTGAGTGGGGATGG - Intergenic
966873714 3:184309187-184309209 TTTTCCACCCAGGGGAGGGAAGG - Intronic
968115165 3:196083737-196083759 TTTTGTATTTTGAGGAGTGACGG + Intergenic
969147738 4:5138948-5138970 TTTTCCACTGAGAGCAATGGAGG + Intronic
969183870 4:5461405-5461427 TTTTGCACCAAAAGGAGTGACGG - Intronic
969956068 4:10892002-10892024 TTTTGCAATTATAGGAGTGCAGG + Intergenic
970199504 4:13588994-13589016 TTTTCCACTTGTAGATGTGAGGG + Intronic
971726228 4:30315932-30315954 TTTTTAACTTAGTGTAGTGACGG - Intergenic
973954895 4:56052951-56052973 TTTTCAACTTAGGGAAGTTAAGG + Intergenic
978199026 4:106003449-106003471 CTGTCCACTTAGAGTAATGAAGG - Intronic
978503209 4:109431601-109431623 TTTTTCACTTATAGTAGTAATGG + Intergenic
979189468 4:117838308-117838330 TTTTCTACATATAAGAGTGAAGG - Intergenic
979567135 4:122167052-122167074 TTTTCTACTAAGAGGAAAGAGGG - Intronic
980888482 4:138788694-138788716 TTTCCCACTGAGAGATGTGAGGG - Intergenic
981433200 4:144686719-144686741 CTTTCCACTTAGAGACGTGTAGG - Intronic
982158899 4:152547726-152547748 TTTACCACTTAAAGGAATCAGGG - Intergenic
985177413 4:187216087-187216109 TTCTCCACTGAGAGGACTCATGG + Intergenic
986072593 5:4300636-4300658 TTTTTCACTTAGTGGAGGCAGGG + Intergenic
986524818 5:8662737-8662759 TTTACCACTTACAGGAGGCAGGG + Intergenic
986924294 5:12728060-12728082 TTTTCCACTTAGTGTAATGTTGG - Intergenic
987149001 5:15019966-15019988 TATTCAACTTAGAGGATTGCAGG + Intergenic
989238722 5:39179402-39179424 TTTTCCATTTTCAGGAGTCAGGG + Intronic
992028614 5:72697382-72697404 TCCTCCACTCACAGGAGTGAAGG + Intergenic
992299208 5:75360707-75360729 TTTTCAACTGGCAGGAGTGAGGG - Exonic
992458159 5:76935532-76935554 CTTTCCATTTAGAGAAGAGATGG - Intergenic
993175124 5:84474172-84474194 TTGACCACTGAGAGGGGTGAGGG + Intergenic
993409689 5:87558531-87558553 TTTTCCACTTAAAGGAATAAGGG - Intergenic
994035382 5:95194363-95194385 TTTTCCACGCAGTAGAGTGAGGG - Intronic
994094002 5:95832476-95832498 TTTTCCTCTTGGAGTAGAGAGGG - Intergenic
994235110 5:97354350-97354372 GTTTCCACTGAGAGGACTGCTGG + Intergenic
999980785 5:156955738-156955760 ATTTCCACTGAAAGGAGAGAAGG - Intronic
1000038561 5:157467577-157467599 TTTTCCACCTAAAAGAGTCAGGG - Intronic
1000664496 5:163978643-163978665 ATTAGCACTTAGAGGAGAGATGG + Intergenic
1001062175 5:168501550-168501572 TTTTCCACTTTTAGTAGAGATGG - Intronic
1001341385 5:170849415-170849437 TTTTCCACTAAGAGGAAAGGAGG + Intergenic
1003531090 6:6938064-6938086 TTTTCCACTTTTAGTAGAGATGG - Intergenic
1003846348 6:10178056-10178078 GTGTCCACTTTGAGGAGAGAGGG + Intronic
1004501040 6:16210397-16210419 TTTTCCACTGACAGGAATGGGGG + Intergenic
1005246358 6:23890084-23890106 TTTTCTTCTTAGAGGAGTAGAGG + Intergenic
1009951268 6:70399577-70399599 CTTTCCTCTTAGTGGAGAGAAGG - Intergenic
1010077245 6:71813878-71813900 TTTAACACTTAGAGCAGAGAAGG + Intergenic
1011165639 6:84442853-84442875 TGTTCCAGCTAGAGGAGGGAAGG + Intergenic
1011774753 6:90717213-90717235 TTTTCCCCCTACAGCAGTGATGG + Intergenic
1011885292 6:92086403-92086425 TTTTTAAGTTAGAGGAGTTAGGG + Intergenic
1015325997 6:131924120-131924142 AATTCCACTTAGAGGAGCAAGGG - Intergenic
1015385062 6:132612734-132612756 TCTACCACTTAGAGGAGTTGGGG + Intergenic
1015406459 6:132842393-132842415 AACTCCACTTAAAGGAGTGAGGG + Intergenic
1015487944 6:133792719-133792741 CTTTCAACTCAGAGGAGTAAAGG - Intergenic
1015777615 6:136830416-136830438 TTTTAGGCTTTGAGGAGTGAAGG + Intronic
1015927288 6:138323047-138323069 TTTTGCTTGTAGAGGAGTGATGG + Intronic
1017605716 6:156130104-156130126 TTTTCCACTTATAAGGATGATGG + Intergenic
1018105601 6:160483373-160483395 TTATCCCCTTGGAGGAGGGATGG + Intergenic
1019005797 6:168795400-168795422 GTTTCCACTTGCATGAGTGAAGG - Intergenic
1022516551 7:30978340-30978362 GTTTCCACAGAGAGGTGTGAAGG + Intronic
1025164843 7:56703582-56703604 TTTCCCACTTAGGGGGGTGTCGG + Intergenic
1025770024 7:64495553-64495575 TGTTCCACTTTGAGGAGTTCCGG - Intergenic
1028504414 7:91555716-91555738 TTTCCCATGAAGAGGAGTGAAGG - Intergenic
1030292145 7:107883476-107883498 TTTTTTTCTTAAAGGAGTGAGGG + Intergenic
1030479959 7:110090690-110090712 TTTTGCACTTTTAGTAGTGATGG - Intergenic
1031003897 7:116450369-116450391 ATTTGCACTCAGAGGAGTGAAGG - Intronic
1033452387 7:141473374-141473396 TTTTCCAGTTGCAGGAGAGAGGG + Exonic
1034021545 7:147648811-147648833 TTTTCCACTTCCAGCAATGATGG - Intronic
1034144090 7:148853047-148853069 TTTTCCACAAAGAGGGGAGAGGG + Intronic
1034713775 7:153220278-153220300 TGGTCCACTTACAGGAGGGAGGG + Intergenic
1036467239 8:9011530-9011552 TCTTCTACTTAGAGGAGTAAAGG + Exonic
1040923304 8:52648689-52648711 TTTTGCAGTTTGAGGTGTGATGG + Intronic
1042028105 8:64445305-64445327 TTTTCCACCTAAAGGAGAAAGGG - Intergenic
1042657322 8:71114033-71114055 TTTTCCCCTTAGAGGAGGGTGGG + Intergenic
1044137498 8:88605476-88605498 TTTAACACTTATAGGAGTCATGG + Intergenic
1045025033 8:98078979-98079001 TTTTCTACTTTGAGGAGGTATGG + Intronic
1045420412 8:102009009-102009031 TTTTTGAATTAGAGGATTGAAGG - Intronic
1048646562 8:136427624-136427646 TTATGCACTTGGGGGAGTGAGGG + Intergenic
1048791954 8:138112459-138112481 TTTTCCAGATAGAGGATGGAGGG - Intergenic
1050217922 9:3348950-3348972 TTTTCCACTAAGAAGAGCCAGGG - Intronic
1053661833 9:40289664-40289686 TTTACTACTTAGGGGAGTTAAGG + Intronic
1053912291 9:42919837-42919859 TTTACTACTTAGGGGAGTTAAGG + Intergenic
1054373960 9:64435900-64435922 TTTACTACTTAGGGGAGTTAAGG + Intergenic
1054522776 9:66086620-66086642 TTTACTACTTAGGGGAGTTAAGG - Intergenic
1055056963 9:72032722-72032744 TTTTGCACTTTTAGGAGAGATGG + Intergenic
1055117289 9:72619009-72619031 TTTTCCACTAAAAGGAATGAGGG + Intronic
1055396840 9:75884851-75884873 TTTTCAACTTCAGGGAGTGAGGG - Intergenic
1055469527 9:76597563-76597585 TTTTTCGCTCAGAGGAGTGGAGG + Intergenic
1055469796 9:76600101-76600123 TTTTTCACTCAGAGTAGTGGAGG + Intergenic
1055615171 9:78064535-78064557 TTTTCCACTCAGAGGCCTAAAGG + Intergenic
1055630634 9:78220048-78220070 CTTTCCTCCTAGAGGGGTGAAGG - Intergenic
1056175619 9:84032079-84032101 TTTTCCACTAAAAGAAGTAAGGG - Intergenic
1060225748 9:121789661-121789683 TTTTCCACTTTTAGTAGAGATGG - Intergenic
1061901283 9:133673418-133673440 CTTTCCACTCAGAGCAGTGGTGG - Intronic
1062286812 9:135776931-135776953 TTTTCCACTAAAAGGAATCAGGG - Intronic
1186003647 X:5043076-5043098 TTTTCTACTTAGAGTAGTGTCGG + Intergenic
1187259882 X:17675530-17675552 GTTTCCTCTGAGAGGAGTCAGGG + Intronic
1193552608 X:82915403-82915425 TTGTCCACTCAGAGGAGTTTTGG + Intergenic
1194051652 X:89076924-89076946 TTGCCCACTTAGAGGATTAAAGG - Intergenic