ID: 1088769806

View in Genome Browser
Species Human (GRCh38)
Location 11:113022700-113022722
Sequence CCTACGTACCTGCCTGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088769806_1088769817 30 Left 1088769806 11:113022700-113022722 CCAAAGGCAGGCAGGTACGTAGG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1088769817 11:113022753-113022775 GTGGTTTCACCATGTGATCGGGG 0: 1
1: 0
2: 4
3: 638
4: 25852
1088769806_1088769813 11 Left 1088769806 11:113022700-113022722 CCAAAGGCAGGCAGGTACGTAGG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1088769813 11:113022734-113022756 GTAGTCCAGGATTGTTATGGTGG 0: 1
1: 0
2: 1
3: 11
4: 120
1088769806_1088769811 -2 Left 1088769806 11:113022700-113022722 CCAAAGGCAGGCAGGTACGTAGG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1088769811 11:113022721-113022743 GGTAGGTAGGTAGGTAGTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 140
1088769806_1088769812 8 Left 1088769806 11:113022700-113022722 CCAAAGGCAGGCAGGTACGTAGG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1088769812 11:113022731-113022753 TAGGTAGTCCAGGATTGTTATGG 0: 1
1: 0
2: 0
3: 18
4: 92
1088769806_1088769816 29 Left 1088769806 11:113022700-113022722 CCAAAGGCAGGCAGGTACGTAGG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1088769816 11:113022752-113022774 GGTGGTTTCACCATGTGATCGGG 0: 1
1: 0
2: 1
3: 71
4: 824
1088769806_1088769815 28 Left 1088769806 11:113022700-113022722 CCAAAGGCAGGCAGGTACGTAGG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1088769815 11:113022751-113022773 TGGTGGTTTCACCATGTGATCGG 0: 1
1: 0
2: 1
3: 17
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088769806 Original CRISPR CCTACGTACCTGCCTGCCTT TGG (reversed) Intronic
900403047 1:2480488-2480510 CCCACCTGCCTGCCTGCCATAGG - Intronic
902652949 1:17848564-17848586 CCAAGGTACCAGCCTGGCTTAGG + Intergenic
903053711 1:20620374-20620396 CCTAGGTACTTGCTTGCCCTGGG - Intergenic
904805231 1:33126688-33126710 CCTACGTGCCTCCCTGCCTGGGG - Intergenic
908528054 1:65007204-65007226 CCCACCTACAGGCCTGCCTTGGG - Intergenic
910394533 1:86778573-86778595 CCTAAGTCTGTGCCTGCCTTTGG - Intergenic
912447617 1:109750017-109750039 CCTTCCTGCCTCCCTGCCTTTGG + Intronic
912729041 1:112085329-112085351 CCTACCTACATGACTACCTTTGG - Intergenic
912958700 1:114175792-114175814 ACAACGTTCCTGTCTGCCTTGGG + Intergenic
915672691 1:157503737-157503759 CCTTTGTAGCTGCCTGCCTCTGG - Intergenic
916411107 1:164548184-164548206 CCTACCTACCTCCCTGACCTTGG + Intergenic
918332432 1:183472657-183472679 CCTACGTACCAGCCCGGCCTCGG - Intronic
922573524 1:226647262-226647284 CCTTCGTACCTGCCTACCATGGG - Exonic
922803562 1:228374739-228374761 CCCACGTACCTGCCTTCCGGAGG - Exonic
1065380178 10:25082195-25082217 CCTACGTATCTACCTACCTAGGG + Intergenic
1069654609 10:70078468-70078490 ACTCAGTGCCTGCCTGCCTTTGG - Intronic
1069726468 10:70583251-70583273 CCTCCCTCCCTGCCTGCCTTCGG + Intergenic
1070826747 10:79394612-79394634 CCTATGTGCCTCCCAGCCTTCGG - Intronic
1071520755 10:86330269-86330291 CCTTCTTACCAGCCTTCCTTGGG + Intronic
1072706831 10:97687107-97687129 CCTACGTACCTGGTTGCTTGAGG + Exonic
1083123757 11:60542132-60542154 CCTACATTCCTTCCTTCCTTGGG - Intronic
1083868376 11:65471281-65471303 CCACCGTACCTGGCTGGCTTTGG + Intergenic
1084374235 11:68764915-68764937 CCAACGTAGCTGGCCGCCTTGGG + Intronic
1084463759 11:69310359-69310381 CCTATGTTCCTCTCTGCCTTTGG + Intronic
1087055459 11:93931629-93931651 TCCACGTACTTGCCTGCATTTGG - Intergenic
1087280763 11:96207471-96207493 ACTACATAACTGCCTGCCTGGGG + Intronic
1088769806 11:113022700-113022722 CCTACGTACCTGCCTGCCTTTGG - Intronic
1089021381 11:115218765-115218787 CCTAAGTACCTCACTGCATTAGG - Intronic
1089541778 11:119193582-119193604 CCCAGGAACCTACCTGCCTTTGG + Intronic
1090422303 11:126583846-126583868 CCTCCCTACCTGGCTGCCTCGGG - Intronic
1090967791 11:131613844-131613866 ACCACGTACCTGCCTTGCTTTGG + Intronic
1092050320 12:5465033-5465055 CCACCTGACCTGCCTGCCTTAGG - Intronic
1092183956 12:6464808-6464830 CCTGCCTGCCTGCCTGCCTGGGG - Intronic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1099973734 12:89525510-89525532 TCCTCGCACCTGCCTGCCTTGGG - Intronic
1102944073 12:116970099-116970121 GCTCCGTGCTTGCCTGCCTTTGG + Intronic
1104078712 12:125411939-125411961 CCTGCCTCCCTGCCTTCCTTGGG + Intronic
1105705553 13:22965729-22965751 CCTGCCTGCCTGCCTGCCTTGGG + Intergenic
1105858458 13:24390714-24390736 CCTGCCTGCCTGCCTGCCTTGGG + Intergenic
1112489313 13:99847791-99847813 CCTGCAGCCCTGCCTGCCTTCGG - Intronic
1112853725 13:103738263-103738285 CCAACGTGCCTGGCTGCTTTGGG + Intergenic
1118906710 14:70028748-70028770 GCTTCCCACCTGCCTGCCTTGGG + Intronic
1120282219 14:82454074-82454096 CCTTCGTACCTCCCTCCCTGTGG - Intergenic
1124212715 15:27776581-27776603 CCTCCATCCCTGCCTGCCATGGG - Intronic
1129674004 15:77622578-77622600 CCCAAGTCCCTGCCTGCCTGAGG + Intronic
1135140022 16:19913236-19913258 CCTAAGTGCCTTCCTTCCTTCGG - Intergenic
1136989998 16:35146233-35146255 ACTACCTACCTGCATGCCTGGGG - Intergenic
1138504154 16:57469143-57469165 CCTGCTTCCCTTCCTGCCTTAGG + Exonic
1138724734 16:59123597-59123619 CCTATGTAACTCCCTTCCTTAGG - Intergenic
1140317497 16:73913230-73913252 CCTGCTTACCTGCCTGCCTATGG + Intergenic
1149666625 17:58369397-58369419 CCCACATCCCTGCCTGCCATGGG + Intronic
1157546392 18:48549628-48549650 CTAACCTTCCTGCCTGCCTTTGG - Intronic
1159695235 18:71548863-71548885 CCTACCTACCTGCCTGCCTATGG + Intergenic
1159892042 18:73962122-73962144 CCTTCCTACCTGCTTGCCTGTGG - Intergenic
1162014666 19:7838686-7838708 CCTGCCTGCCTGCCTGCCCTAGG - Intronic
1166689141 19:44812413-44812435 CCTCCCTGCCTGCCTCCCTTCGG - Intronic
1168524572 19:57078701-57078723 CCTGCCTGCCTGCCTGCCTGGGG - Intergenic
927365385 2:22289542-22289564 CATACTTAGCTGCCTGCTTTAGG - Intergenic
927723631 2:25404192-25404214 CATACGTACCTGACTCCCTCGGG - Intronic
930541304 2:52710347-52710369 CCTCAGTATCTACCTGCCTTAGG + Intergenic
930567775 2:53044474-53044496 CTTCCCTACCTGCCAGCCTTAGG + Intergenic
938539859 2:132277013-132277035 CCTACATACCTACCTACCTACGG + Intergenic
938612449 2:132962103-132962125 CTTGCTTACCTGTCTGCCTTCGG + Intronic
942141873 2:172985130-172985152 CCCACTTGCCTGCCTGTCTTTGG - Intronic
946562862 2:220932245-220932267 CCTACATACCTAACAGCCTTTGG - Intergenic
946799004 2:223389649-223389671 GCTACGTACTTGCATGCCTTAGG + Intergenic
947238623 2:227970313-227970335 CCTAAGCACCTGGCTGGCTTTGG - Intergenic
947584782 2:231347824-231347846 CCTCTCTCCCTGCCTGCCTTTGG + Intronic
948323399 2:237090866-237090888 CCCATCTATCTGCCTGCCTTAGG - Intronic
1169210881 20:3765739-3765761 CCTAGGGACCTGGCTGCTTTGGG - Intronic
1172663908 20:36586079-36586101 CCTACATCCCTGGCTGCCCTGGG - Intronic
1173330900 20:42075559-42075581 CCTTGGTACCTCACTGCCTTGGG - Exonic
1176205081 20:63883841-63883863 CCTCCCTGCCTGCCTGCCTTAGG + Intronic
1176553791 21:8243855-8243877 CCTGCCTGCCTGCCTGCCTGTGG - Intergenic
1176572713 21:8426879-8426901 CCTGCCTGCCTGCCTGCCTGTGG - Intergenic
1176580622 21:8471440-8471462 CCTGCCTGCCTGCCTGCCTGTGG - Intergenic
1178803086 21:35815368-35815390 CCTATGTGCATGCCTGCATTAGG - Intronic
1179635452 21:42705797-42705819 CCCACATTCCTGCCTGCCCTAGG + Intronic
1180622234 22:17169872-17169894 CCTACCTACCTGCATGCTATAGG + Intergenic
1180943835 22:19678912-19678934 CCTACGGAACTGCCTCCCCTGGG - Intergenic
1181025557 22:20125450-20125472 CCTGGGGACCTGCCTGACTTGGG + Intronic
1182108749 22:27707721-27707743 CGAACCCACCTGCCTGCCTTCGG + Intergenic
1182278385 22:29204671-29204693 CCTGCCTGCCTGCCTGCCTATGG + Intergenic
1182575509 22:31270371-31270393 CCTGCCTGCCTGCCTGCCTGAGG - Intronic
1184747183 22:46463141-46463163 CCGACTTAACTGCCTGCTTTAGG - Intronic
1185070392 22:48652779-48652801 GCTGGGTACCTGCCTGCCTCAGG + Intronic
1203258795 22_KI270733v1_random:160887-160909 CCTGCCTGCCTGCCTGCCTGTGG - Intergenic
949566599 3:5251107-5251129 CCTGCCTGCCTGCCTGCCTGGGG + Intergenic
950684573 3:14607211-14607233 CCCAGGAACCTGCCGGCCTTTGG + Intergenic
952051267 3:29387496-29387518 CCTACATAATTGCCTGCCTATGG + Intronic
952053334 3:29413134-29413156 CCTAGTGATCTGCCTGCCTTGGG - Intronic
957501831 3:81067314-81067336 CCTTCGTACCTGCAAGCCTTCGG + Intergenic
962860275 3:139393128-139393150 ACTATGTACCTACCTGCCATTGG + Intergenic
966747607 3:183292922-183292944 CCTCCTTTCCTGCCTTCCTTTGG - Intronic
969447445 4:7253340-7253362 CCTGTGTCCCTGCCTGCCTCTGG + Intronic
976121864 4:81791908-81791930 TCTGCCTACCTTCCTGCCTTTGG + Intronic
976567608 4:86569549-86569571 CCTACCTACCTACCTACCTGTGG + Intronic
984666575 4:182435600-182435622 CCTGCCTGCCTGCCTTCCTTGGG + Intronic
988962316 5:36382503-36382525 CCTATGTACATGCCTGTCTCTGG - Intergenic
992622780 5:78610229-78610251 CCTGCATTCCTGCCTGCCCTTGG - Intronic
992996033 5:82334485-82334507 CCTACATATTTTCCTGCCTTCGG + Intronic
1000022857 5:157333614-157333636 CTTACGTTCCTGATTGCCTTGGG + Intronic
1000581233 5:163037160-163037182 CCTATGTGCCTGTGTGCCTTGGG - Intergenic
1000689434 5:164296666-164296688 CCTGCCTGCCTGCCTGCCTGAGG + Intergenic
1023042019 7:36180523-36180545 CCTGCCTACCTCCCTGCTTTAGG - Intronic
1023105784 7:36761989-36762011 CCTACTTAAATGCCTGCCTGAGG + Intergenic
1027173326 7:75888137-75888159 CCTCCGTACCAGCCTGCCTCCGG + Exonic
1027190347 7:75992719-75992741 CCCAGGTCCTTGCCTGCCTTGGG - Intronic
1033159192 7:138981549-138981571 CCTGCCTGCCTGCCTGCCTGCGG + Intergenic
1034549120 7:151809147-151809169 CCTGCGTAAATGCCTGCCTTGGG + Intronic
1038444321 8:27592947-27592969 CCGACCTACCCGCCTTCCTTAGG - Intergenic
1039529935 8:38251815-38251837 CCTACCTACCTACCTACCTCAGG + Intronic
1045366544 8:101481596-101481618 CCTTCTTTCTTGCCTGCCTTAGG + Intergenic
1047261575 8:123266078-123266100 CCTACCTACCTGCCAGCTGTGGG - Intronic
1048706819 8:137162890-137162912 CCTTCCTGCCTGCCTGCCTGTGG + Intergenic
1057159109 9:92873142-92873164 CCTGCCTGCCTGCCTGCCTATGG - Intronic
1060792188 9:126493890-126493912 GCGACGTAACTGCCTGCCTGGGG - Intronic
1061673451 9:132202231-132202253 CCTACATTGCTGCCTGCCATTGG - Intronic
1203474985 Un_GL000220v1:142898-142920 CCTGCCTGCCTGCCTGCCTGTGG - Intergenic
1186401461 X:9264049-9264071 CCTTCCTACCTCCCTTCCTTGGG + Intergenic
1187387764 X:18863877-18863899 CCTAAGGGCCTGCCTGCCATAGG - Intergenic
1188515385 X:30980362-30980384 CCCTCCTTCCTGCCTGCCTTGGG + Intergenic
1189285954 X:39852610-39852632 CCTACCTGCCTCCCTGCCTGTGG - Intergenic
1195878970 X:109572962-109572984 CCTACTTCCCTTCCTCCCTTTGG + Intergenic
1196027976 X:111062720-111062742 CCTGCCTGCCTACCTGCCTTAGG + Intronic
1199671364 X:150150931-150150953 CCTGAGTACCTGCCTACCTCTGG + Intergenic
1201633597 Y:16097200-16097222 CCTACCTACCTACCTACCTGAGG - Intergenic