ID: 1088772515

View in Genome Browser
Species Human (GRCh38)
Location 11:113049383-113049405
Sequence CCTTTGAAACTCATGGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088772512_1088772515 -7 Left 1088772512 11:113049367-113049389 CCTTTATTTAGAAATGCCTTTGA 0: 1
1: 0
2: 0
3: 31
4: 334
Right 1088772515 11:113049383-113049405 CCTTTGAAACTCATGGATCAAGG 0: 1
1: 1
2: 3
3: 16
4: 189
1088772511_1088772515 -6 Left 1088772511 11:113049366-113049388 CCCTTTATTTAGAAATGCCTTTG 0: 1
1: 0
2: 1
3: 45
4: 534
Right 1088772515 11:113049383-113049405 CCTTTGAAACTCATGGATCAAGG 0: 1
1: 1
2: 3
3: 16
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088772515 Original CRISPR CCTTTGAAACTCATGGATCA AGG Intronic
901261267 1:7873260-7873282 ACTCTGATGCTCATGGATCAAGG + Intergenic
909282843 1:73778155-73778177 TCTTTGCAACTATTGGATCAAGG + Intergenic
909366581 1:74830663-74830685 TCTTGGAAACTGATGAATCATGG - Intergenic
910545665 1:88414191-88414213 ATTGTGAAACCCATGGATCATGG - Intergenic
911265937 1:95743155-95743177 CCTTTGAAAGAACTGGATCACGG - Intergenic
912482331 1:109992847-109992869 CTTCTGAAACTCATGGATCCTGG + Intronic
912629801 1:111236829-111236851 CCCTGGAAATTCAGGGATCAGGG + Intronic
913097307 1:115531027-115531049 CCTTTTAAACTCATTAATGATGG - Intergenic
916205777 1:162315109-162315131 CCTTGGAATCACATGGATGATGG + Intronic
920062406 1:203236533-203236555 TCTTTAAACCCCATGGATCATGG - Intronic
920395475 1:205642484-205642506 TCTTTGAAACTCATTGATCAGGG + Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
923426645 1:233876775-233876797 CCTTTGAAACTAATAGGTCAAGG - Intergenic
923940443 1:238817389-238817411 CCTATCAAACTTATGGTTCATGG + Intergenic
924080774 1:240395348-240395370 ATTTTGTAGCTCATGGATCAAGG + Intronic
1063044293 10:2376435-2376457 CCTTTTAAAAACATGGAACATGG + Intergenic
1063231916 10:4073808-4073830 CCTTTTATGCTCATGAATCATGG + Intergenic
1063702269 10:8396010-8396032 CATTTGAAAATCATTGGTCAAGG + Intergenic
1065914619 10:30343513-30343535 GCTATGAAACTGATGGATCAAGG + Intronic
1067301778 10:45017955-45017977 ACTCTGTAGCTCATGGATCAAGG - Intergenic
1067582908 10:47456786-47456808 CCTCTGAATCTCATGGAGCCAGG - Intergenic
1068327796 10:55517417-55517439 ACTTTGGAGCTCATGGGTCACGG - Intronic
1071599664 10:86952368-86952390 CCATGGAAACTCCTGGAACATGG + Intronic
1072304340 10:94093069-94093091 CCTTTAGAACTCTTGGATGAAGG - Intronic
1072927744 10:99631144-99631166 GCTTTGAAAGTCATGTTTCAAGG + Intergenic
1073825425 10:107315191-107315213 CCCTTGACACTGAAGGATCAGGG - Intergenic
1074261784 10:111861455-111861477 ACTAGGAAATTCATGGATCAGGG + Intergenic
1074853722 10:117458190-117458212 CTTTCCAAACTCCTGGATCAGGG - Intergenic
1075371364 10:121938330-121938352 CCTTTATTACTCATGGATAATGG - Intergenic
1077351496 11:2095183-2095205 CCTCTGAAACTCTGGGAACAAGG - Intergenic
1080276085 11:30504780-30504802 CCTCTGAAACTCATGCATTAGGG + Intronic
1081090908 11:38865521-38865543 CCTGTGAAACTTATGGTTTAAGG + Intergenic
1084233156 11:67768054-67768076 CCTGGGTAACTCATGGAGCAAGG + Intergenic
1084605231 11:70168366-70168388 CCTTTCAAACACAGTGATCAGGG - Intronic
1087625958 11:100596474-100596496 CCTTTGAGGCTCTGGGATCATGG - Intergenic
1088042936 11:105410601-105410623 CCTTTGAAGCTAATGTATAAAGG - Intergenic
1088772515 11:113049383-113049405 CCTTTGAAACTCATGGATCAAGG + Intronic
1090706084 11:129338262-129338284 CATTTGAACCTCATTGACCATGG - Intergenic
1092458235 12:8663958-8663980 CCTTTAAAATTCCTGAATCAAGG - Intergenic
1094607647 12:31962795-31962817 CTTTTAAAGTTCATGGATCAGGG + Intronic
1097074578 12:56383491-56383513 CTTTTGACTCTCATGGATGAGGG + Intergenic
1099794139 12:87376022-87376044 CCTTTGAACTTCATGGATTCAGG + Intergenic
1099886643 12:88539152-88539174 CCTTTGGATCTCATGGTTCAAGG + Intronic
1100832717 12:98531709-98531731 CTTTTGAAACTGAGGGAACAAGG + Exonic
1103863043 12:124029500-124029522 CCTTTAAAAGTCATAAATCAAGG + Intronic
1108629675 13:52269271-52269293 TCTTTGCAACCCATGGATCAGGG - Intergenic
1108656383 13:52537217-52537239 TCTTTGCAACCCATGGATCAGGG + Intergenic
1110801982 13:79708792-79708814 TATTTTACACTCATGGATCAGGG + Intergenic
1116277803 14:42859388-42859410 CATTAGAAACCCATGGATCTTGG - Intergenic
1118948025 14:70406828-70406850 CCCTGAAAACTCAGGGATCAGGG - Intronic
1122134640 14:99625781-99625803 CCTTTGAAACTCAGGGTTCTTGG - Intergenic
1124115782 15:26842275-26842297 CCCTTTCAACTCATGGCTCAAGG - Intronic
1125073460 15:35584201-35584223 ACATAGAAAATCATGGATCATGG + Intergenic
1126527748 15:49676476-49676498 CCTATGTAACTCAAGTATCAGGG - Intergenic
1126879485 15:53079072-53079094 CCTTTAAAACTTATGTTTCAAGG - Intergenic
1127649559 15:60993915-60993937 CCTTTGAAAATTATGTATCTAGG - Intronic
1128174047 15:65538117-65538139 CTTTTGCAGCCCATGGATCAAGG + Intronic
1131469739 15:92685775-92685797 CCTAAGGAACTCATGGATCTAGG + Intronic
1132657677 16:1048204-1048226 CCTTTGCTACTCAGGGTTCAGGG - Intergenic
1132807324 16:1781083-1781105 CCTCTGAAACACATGGTGCATGG - Intronic
1138794383 16:59950337-59950359 CCTTTGAAACTTCTTTATCAAGG + Intergenic
1140400599 16:74667770-74667792 CTTTTGAAACTGAGGGAGCAAGG + Intergenic
1141032568 16:80602512-80602534 TCTTTGAAACTCAAAGCTCAGGG + Exonic
1141349511 16:83280749-83280771 ATTTTTCAACTCATGGATCAAGG - Intronic
1144130564 17:12242747-12242769 TCTTTGACACTGATGGAGCAGGG + Intergenic
1144333509 17:14247772-14247794 TCTTTGGAACTCATGGAGAAAGG - Intergenic
1144858929 17:18287630-18287652 CCCTTGAAACCCAGGGTTCATGG + Intronic
1146732989 17:35211906-35211928 CCTCAGAAACTCAAAGATCAGGG - Intergenic
1148418296 17:47525231-47525253 CATTGGAATCTCTTGGATCATGG + Intronic
1150125606 17:62632647-62632669 CCTTCGAGACTCAAGGATCCTGG + Intronic
1155853784 18:30806327-30806349 ACTCTGCAACCCATGGATCAAGG + Intergenic
1156476363 18:37408345-37408367 CCTTTGAAAGATATGGTTCAGGG - Intronic
1159970285 18:74643083-74643105 CCTTTGAAACACATGAAATAGGG - Intronic
1164601236 19:29565008-29565030 CCTCTGAAACTCATAGATTTGGG + Intergenic
925647593 2:6052743-6052765 GCTTTGCAACTCATGAAACAAGG - Intergenic
927014308 2:18941395-18941417 ATTCTGCAACTCATGGATCAAGG - Intergenic
927098798 2:19770837-19770859 CCCTTGACACTCAGGGATTATGG + Intergenic
928849967 2:35734116-35734138 TCTTTGCAACCCACGGATCAGGG + Intergenic
930189700 2:48444785-48444807 CATTTGAAAATCATTGATCAAGG + Intronic
930399656 2:50867074-50867096 CCTCTGAAACTCAATGCTCATGG - Intronic
930401936 2:50901133-50901155 CAGATGAAAATCATGGATCATGG - Intronic
930547043 2:52781459-52781481 CCTTTCAGAGTCATGAATCACGG + Intergenic
931141789 2:59467507-59467529 ACTCTGCAACTCATGGATCAAGG - Intergenic
931899309 2:66770185-66770207 TCTATGAAACACATGTATCAAGG - Intergenic
932006173 2:67929325-67929347 CCTGGGAATCTCATCGATCAGGG - Intergenic
933431617 2:82188911-82188933 CCTGTGGAGCTCATGCATCAAGG - Intergenic
934474262 2:94582773-94582795 TCTTTAAAAATCATGGATTAGGG - Intergenic
934548378 2:95238523-95238545 ACTCTGAAGCCCATGGATCAAGG + Intronic
937521247 2:122714875-122714897 TCTTTGAAACTAATAGAACAAGG + Intergenic
937678258 2:124615815-124615837 ACTCTGCAGCTCATGGATCAAGG - Intronic
938623353 2:133081111-133081133 CCTTTGAAATACACAGATCATGG - Intronic
939180737 2:138799743-138799765 CCTTTGCATCTCAGGGATGAAGG - Intergenic
942884148 2:180901961-180901983 CCTTTGAGAGTCATGGGACAAGG + Intergenic
942893895 2:181026534-181026556 CCTTTGGAAAGCATGTATCAAGG - Intronic
943439842 2:187915304-187915326 CAGTTCAAACTCATGGTTCAAGG + Intergenic
944236486 2:197445855-197445877 CCTTAGAGACTCAAGGCTCAAGG - Intergenic
944304696 2:198165902-198165924 CTTTTGAAAATGTTGGATCAGGG + Intronic
944767671 2:202881195-202881217 CCTTTCAAACTTATGTATCTTGG - Intronic
948209253 2:236179828-236179850 CCTTTGAATCTCCTGGCTGAGGG + Intergenic
948791912 2:240383577-240383599 CCTCTGAACCTCGTGGCTCATGG - Intergenic
1168862641 20:1056880-1056902 CCTCTGAAACACATGGATCTGGG - Intergenic
1170050652 20:12141029-12141051 ATTTTGCAACTGATGGATCATGG + Intergenic
1172530673 20:35629202-35629224 CCCTTGGAACTCAGGGGTCAGGG - Intronic
1173138072 20:40457818-40457840 CCTTTGATCCTCATAGATAAAGG + Intergenic
1177262918 21:18752473-18752495 CTTTTGAAAGAGATGGATCATGG - Intergenic
1182731265 22:32496745-32496767 ATTCTGAAGCTCATGGATCAAGG + Intronic
1183645118 22:39121302-39121324 CCTTTGAAATTCTATGATCATGG + Intronic
1184750932 22:46486246-46486268 CTTTTTAAAGTCATGCATCAAGG + Intronic
949156375 3:831451-831473 CCCTTGAAACACAGGGATTATGG + Intergenic
949500786 3:4678353-4678375 ACTTTGGAACACATGGACCATGG - Intronic
949578306 3:5360568-5360590 ACTATGAAACTCATGAAGCAAGG - Intergenic
949638389 3:6009442-6009464 CATTTGAAACTCCTGATTCATGG + Intergenic
951453077 3:22861602-22861624 ACTTTGAACCTAATGGATCCTGG + Intergenic
953208756 3:40855566-40855588 CCTTTGAAACTCATGGAACAAGG - Intergenic
954554602 3:51507958-51507980 AATTTGAAAATCATGGATCTAGG - Intergenic
956285835 3:67609051-67609073 CCTGTGAATCTCATGCAGCATGG + Intronic
957469040 3:80634593-80634615 ATTCTGAAGCTCATGGATCAAGG - Intergenic
958695560 3:97523278-97523300 CCTGTACAACTAATGGATCAAGG - Intronic
960203395 3:114865785-114865807 CATTTAAAATTCATGGATGAAGG + Intronic
963505254 3:146177220-146177242 CCTGTGAAACTTCTGGATCCTGG - Intergenic
964886140 3:161485182-161485204 CCATTTAGAATCATGGATCAAGG - Intergenic
966073814 3:175911078-175911100 CATTTGAAACTCAGGAATCAGGG - Intergenic
967132934 3:186489141-186489163 CCTGTGAAAATGATGGCTCAGGG + Intergenic
969858316 4:10017616-10017638 CCTTTGAAACTCACTGACCCAGG + Intronic
969877134 4:10144012-10144034 CCACTGACACTCATGGCTCATGG + Intergenic
970684573 4:18551601-18551623 ACTTTCAAACTCATGTAACAAGG - Intergenic
975023764 4:69523349-69523371 ATTTTGCAACCCATGGATCAAGG - Intronic
976587995 4:86820208-86820230 TCTTTAAAACTCATGGAGCCCGG + Intergenic
976991625 4:91374647-91374669 ATTCTGCAACTCATGGATCAAGG + Intronic
978253795 4:106668720-106668742 CTTTTGAAGCTCTTTGATCAAGG + Intergenic
978523333 4:109639225-109639247 ATTTTGAAGCCCATGGATCAAGG - Intronic
980782184 4:137505221-137505243 CCTTTGAAACATGTGGATTATGG + Intergenic
981658764 4:147141997-147142019 CTTCTGCAGCTCATGGATCAAGG + Intergenic
981682197 4:147411947-147411969 CCTTTGAAATTAAAGGAACATGG + Intergenic
982453605 4:155581118-155581140 CCCTTCAAAATCATGCATCAGGG - Intergenic
984121305 4:175748384-175748406 GCTTTGAAACCCGTGGATCAAGG - Intronic
984903893 4:184609379-184609401 CCTTGAAAACTCATGGATCAGGG - Intergenic
987899948 5:23998483-23998505 ACATTGGAAATCATGGATCAAGG - Intronic
992856519 5:80867194-80867216 CCTCTGGAAGTCATGGAACATGG - Intronic
993524512 5:88947824-88947846 ACTTGGAAACTCAGTGATCAGGG + Intergenic
995042690 5:107607085-107607107 ACTTTGAAACTCAAGGCTAATGG - Intronic
995705194 5:114981616-114981638 GCTTTGAAACTTATGGAATAAGG - Intergenic
996072537 5:119149815-119149837 CTTTTGGAACTCATGGATCTTGG + Exonic
996132523 5:119798790-119798812 CCCTGAAAACTCAGGGATCAGGG - Intergenic
996804482 5:127439495-127439517 CCTTTTCAACTCTTGGTTCAAGG - Intronic
996995540 5:129692547-129692569 CCTTTGCAGCTCATGCAACAAGG - Intronic
999717930 5:154376977-154376999 ACTTTGACACTTATGGCTCAAGG - Intronic
1003145507 6:3506879-3506901 CCTTTGAAAGTGCTGGCTCATGG - Intergenic
1003265108 6:4558966-4558988 CCTTGGAAACTGAGTGATCATGG + Intergenic
1003716650 6:8653931-8653953 CCTCTGAAACTCAGAGACCAAGG + Intergenic
1004588029 6:17021636-17021658 GGTTTGAAACTCATGGATATAGG + Intergenic
1006245302 6:32729090-32729112 ATTCTGCAACTCATGGATCAAGG + Intergenic
1006743823 6:36327348-36327370 CCTTTGAAAGTCACAGATCTAGG + Intronic
1007885733 6:45227707-45227729 CCTTTGAATCTTATTGTTCATGG - Intronic
1009525623 6:64741167-64741189 CTTCTGAAGCCCATGGATCAAGG - Intronic
1012390575 6:98733795-98733817 ATTTTGTAGCTCATGGATCAAGG - Intergenic
1014676568 6:124374434-124374456 CCTATGAAACTCATGGAAGCTGG + Intronic
1016046819 6:139489485-139489507 CCTTATAAAATGATGGATCAAGG - Intergenic
1017122428 6:151037195-151037217 TCTTTAAAAATCATGGATTAGGG + Intronic
1019983161 7:4636518-4636540 ACTAGGAAACTCATGGATCCAGG - Intergenic
1021031296 7:15739621-15739643 CCTTTGAAGGTCAGGGACCAAGG + Intergenic
1025086535 7:56028069-56028091 CCTTTCAAACTCAAGGCTGATGG - Intronic
1027594938 7:80161813-80161835 CCCCTGAAACTACTGGATCATGG + Intronic
1027965777 7:85004902-85004924 CCATTGAAATTCATGGAGCATGG + Intronic
1028528426 7:91811222-91811244 CCTTTCAAAACCATAGATCAAGG - Intronic
1028679062 7:93504575-93504597 TCTTAAAAACTTATGGATCATGG - Intronic
1029028837 7:97447646-97447668 CTTATGAAAGTCATGAATCATGG + Intergenic
1033452533 7:141474522-141474544 CCTTTCAACTTCAGGGATCATGG + Exonic
1033604934 7:142919917-142919939 CCTTTGCAAGTCTGGGATCATGG - Intronic
1034361876 7:150506549-150506571 CTTCTGCAGCTCATGGATCAAGG + Intergenic
1035033075 7:155876036-155876058 CATTTAAAACTTATAGATCAGGG - Intergenic
1035764367 8:2093948-2093970 CCTGAGAAACACAGGGATCAGGG - Exonic
1037327747 8:17710812-17710834 ACTTTGCAGCCCATGGATCAAGG - Intronic
1037812286 8:22094300-22094322 CCTTTGAAAGCCAGGGAGCAGGG + Intronic
1039105312 8:33983479-33983501 CCTTAGAAACTAAAGTATCACGG - Intergenic
1041542091 8:58996814-58996836 CGATGGAAACTCAAGGATCATGG - Intronic
1042785975 8:72547299-72547321 ACTCTGCAGCTCATGGATCAAGG + Intronic
1042908143 8:73795653-73795675 CCCTTGAAATTACTGGATCATGG - Intronic
1044791336 8:95850065-95850087 CCTTTGAAACCCATAGAACGTGG + Intergenic
1045759877 8:105592242-105592264 CCTTTGAAAACAATGCATCAGGG - Intronic
1046791555 8:118327633-118327655 CCTTTCAAAATCATGGAATAAGG + Intronic
1046966331 8:120170392-120170414 TCTAAGTAACTCATGGATCAAGG - Intronic
1048024279 8:130570259-130570281 CTTTTGACTCTCAAGGATCACGG + Intergenic
1050122459 9:2321480-2321502 GGATTGAAACTCAGGGATCAGGG - Intergenic
1052630627 9:31034110-31034132 CCTTAGAAGCTCATGGTTCTTGG - Intergenic
1053285885 9:36849275-36849297 CCTTTTAAACACAGTGATCAGGG - Intronic
1053683815 9:40503361-40503383 TCTTTAAAAATCATGGATTAGGG + Intergenic
1053933789 9:43131647-43131669 TCTTTAAAAATCATGGATTAGGG + Intergenic
1054279905 9:63121591-63121613 TCTTTAAAAATCATGGATTAGGG - Intergenic
1054296909 9:63338827-63338849 TCTTTAAAAATCATGGATTAGGG + Intergenic
1054394929 9:64643333-64643355 TCTTTAAAAATCATGGATTAGGG + Intergenic
1054429576 9:65148533-65148555 TCTTTAAAAATCATGGATTAGGG + Intergenic
1054500805 9:65872998-65873020 TCTTTAAAAATCATGGATTAGGG - Intergenic
1054771072 9:69084565-69084587 CATTTGCAATTCATGGATCAGGG - Intronic
1054892792 9:70270366-70270388 TCTCTGAAACCCATGGTTCAGGG + Intronic
1055106389 9:72517766-72517788 CCTTTGGAACTTTTGGATGATGG + Intergenic
1055142241 9:72888854-72888876 TCTAAGAAACTTATGGATCAGGG + Intergenic
1057431164 9:94995599-94995621 TCCTTGAAACTCAGAGATCAAGG + Intronic
1059929730 9:119249060-119249082 CCTTTGAAACTCCGGCATGAGGG + Exonic
1060694418 9:125694783-125694805 CCTTAGATAGTCATGCATCAGGG - Intronic
1187486396 X:19708201-19708223 CTTTTGAAACATATTGATCAGGG - Intronic
1187539504 X:20178124-20178146 CCCATGAAACTCATGGTCCATGG + Intronic
1188980925 X:36726431-36726453 CCTTTGAAACTCATGCAGCAGGG + Intergenic
1189258520 X:39659498-39659520 CCTCTGAAACTGATGAATAAAGG - Intergenic
1190464349 X:50710768-50710790 CCTTTGAAACCCAGGCTTCAAGG - Intronic
1193855776 X:86599848-86599870 CCTTTGAATCACATGGGGCAAGG + Intronic
1194540128 X:95159540-95159562 CCTTTGACACACAGGGATTATGG - Intergenic
1195690773 X:107622980-107623002 ATTCTGAAGCTCATGGATCAAGG - Intergenic
1196273310 X:113737149-113737171 CATTTGATACTCATGGATATTGG - Intergenic
1199178878 X:144828582-144828604 CCTGTGATACTCCTGGAACATGG + Intergenic