ID: 1088772980

View in Genome Browser
Species Human (GRCh38)
Location 11:113054152-113054174
Sequence CTCGGCTGGTAGCCTGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088772980_1088772984 -2 Left 1088772980 11:113054152-113054174 CCAGATTCAGGCTACCAGCCGAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1088772984 11:113054173-113054195 AGTGAGTTAACTGAGGAAATAGG 0: 1
1: 0
2: 0
3: 22
4: 270
1088772980_1088772982 -9 Left 1088772980 11:113054152-113054174 CCAGATTCAGGCTACCAGCCGAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1088772982 11:113054166-113054188 CCAGCCGAGTGAGTTAACTGAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1088772980_1088772986 22 Left 1088772980 11:113054152-113054174 CCAGATTCAGGCTACCAGCCGAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1088772986 11:113054197-113054219 ACGTTTTTGGTGAGAGACTGAGG 0: 1
1: 0
2: 1
3: 14
4: 137
1088772980_1088772985 9 Left 1088772980 11:113054152-113054174 CCAGATTCAGGCTACCAGCCGAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1088772985 11:113054184-113054206 TGAGGAAATAGGCACGTTTTTGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088772980 Original CRISPR CTCGGCTGGTAGCCTGAATC TGG (reversed) Intronic
901503460 1:9668793-9668815 CTCGGCTGGCTGACTGGATCTGG + Intronic
905979552 1:42211278-42211300 CTCTCATGGAAGCCTGAATCTGG - Intronic
914578266 1:148996447-148996469 CTCTGCTGGCAGGCTTAATCAGG - Intronic
915274613 1:154779616-154779638 GTCAGCTGGTAGACTGAATCAGG + Intronic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
1064369761 10:14741135-14741157 CTCACCTGGTACCCTGATTCTGG - Intronic
1069670390 10:70197414-70197436 CTCCCCTGGTTGCCTGATTCTGG - Intergenic
1070823839 10:79379685-79379707 GCCGGCTGGTAGCCTGAGCCTGG + Intergenic
1076962462 10:133775704-133775726 CTTGGCTTTTAGCCTGAATAAGG - Intergenic
1080154048 11:29087631-29087653 CTCGGGTGGTATCCTGCTTCTGG - Intergenic
1081745208 11:45468108-45468130 CTCAGCTTGGAGCATGAATCAGG - Intergenic
1084775814 11:71374354-71374376 CTCTGATGGTGGCCTGATTCTGG - Intergenic
1088772980 11:113054152-113054174 CTCGGCTGGTAGCCTGAATCTGG - Intronic
1091937853 12:4447500-4447522 CTCAGCTGGTAAACTGAATGGGG + Intergenic
1095584390 12:43834973-43834995 CTGTACTGGTAGCCTGATTCAGG - Intergenic
1098918411 12:76280472-76280494 CTCGGCTGGGAGGCTGTTTCAGG - Intergenic
1100492836 12:95098004-95098026 CACGGCTGGCAGACTGAATGAGG - Intronic
1113988969 13:114343613-114343635 CTTGGCTTTTAGCCTGAATAAGG - Intergenic
1115427956 14:33282704-33282726 CTCGACTGCTAGCCTGGAGCGGG + Intronic
1117677722 14:58171356-58171378 CTCAGCTGGGAGCCAGAAGCAGG + Intronic
1122599455 14:102914032-102914054 CTCGGCTGCTGGGCTGGATCAGG + Intergenic
1128284867 15:66428454-66428476 TTCTGCTGGTAGCCTGCCTCTGG - Intronic
1141396653 16:83711031-83711053 CTCTGCTGGTGGCCAGAATGAGG - Intronic
1144088467 17:11831950-11831972 CCCTGCTGGTCCCCTGAATCGGG - Intronic
1148032146 17:44628749-44628771 CTGGGCTGGTACCCCGAGTCAGG + Intergenic
1152951576 17:83237369-83237391 CTTGGCTTTTAGCCTGAATAAGG - Intergenic
1154506919 18:15050210-15050232 CTTGGCTGATAGGCTGAGTCTGG - Intergenic
1156571149 18:38254702-38254724 CTCAGCTGGTATTCAGAATCAGG + Intergenic
1160633085 18:80260189-80260211 CTTGGCTTTTAGCCTGAATAAGG - Intergenic
1160983798 19:1828286-1828308 GTGGGCTGGTAGCCGGCATCAGG + Exonic
1162407788 19:10486094-10486116 CTGGGCTGGAGGCCTGAAACCGG - Intergenic
1166091538 19:40512596-40512618 CAGGGCTGGTAGCCTGAGCCAGG - Exonic
1167218922 19:48184572-48184594 TTGGGCTGGTGGCTTGAATCAGG - Intronic
1167264238 19:48475478-48475500 CACAGCTGGAAGCCAGAATCTGG - Intronic
1168727607 19:58596408-58596430 CTTGGCTTTTAGCCTGAATAAGG - Intergenic
925051583 2:819674-819696 CCCGGCTGGTAGGCTGGAGCGGG + Intergenic
928422299 2:31147855-31147877 CTAGGCTGGGAGTCTGAAACCGG + Intronic
929857593 2:45650178-45650200 CTCGGCTGGGAGCCGGGACCGGG - Intergenic
932097088 2:68860527-68860549 CTCAGCTGGCAGGCTGAATCTGG - Intergenic
936570947 2:113614786-113614808 CTTGGCTTTTAGCCTGAATAAGG + Intergenic
939359994 2:141158880-141158902 CTCAGCTGGAAGCATCAATCTGG + Intronic
945309509 2:208294873-208294895 CTCTGCTGGAAGCCAGAAGCCGG + Intronic
1172127191 20:32631748-32631770 CATGGCTGGGAGCCTGAAGCAGG + Intergenic
1175693710 20:61085210-61085232 CTCAGCTGGTGGCCTGACACAGG - Intergenic
1176790952 21:13318891-13318913 CTTGGCTGATAGGCTGAGTCTGG + Intergenic
1179804678 21:43829719-43829741 CTCAGCTGGGAGCCTGAGTGTGG - Intergenic
1180263047 21:46688210-46688232 CTTGGCTTTTAGCCTGAATAAGG - Intergenic
1184652416 22:45925281-45925303 CTAGGCTGGCAGCCTGGAGCTGG + Intronic
1185429247 22:50796089-50796111 CTTGGCTTTTAGCCTGAATAAGG - Intergenic
952340212 3:32439301-32439323 CTCAGCTGGAAGCTTGAAGCAGG - Intronic
957079832 3:75627686-75627708 CTTGGCTTTTAGCCTGAATAAGG + Intergenic
959225443 3:103577102-103577124 CTCTTTTGGTAGCCTGAATATGG + Intergenic
985461919 4:190115459-190115481 CTTGGCTTTTAGCCTGAATAAGG - Intergenic
985465695 4:190193184-190193206 CTTGGCTTTTAGCCTGAATAAGG - Intergenic
987069515 5:14322587-14322609 CTCTGCAGGAAGCCTGACTCAGG + Intronic
990347517 5:54884339-54884361 CTCCGCTGGTAGCATCAAACTGG + Intergenic
998807425 5:145932468-145932490 CTCTGCATGTGGCCTGAATCTGG + Intergenic
1020118848 7:5491703-5491725 CTCGGCTGGTGACTTGAAGCCGG - Intronic
1020513130 7:9084536-9084558 CTCGGGTGGTAGCCTGTACAAGG + Intergenic
1023654257 7:42403933-42403955 CCCAGCTGAGAGCCTGAATCAGG - Intergenic
1036926328 8:12909522-12909544 CTGGGCTGGGAGCCTGACTTGGG + Intergenic
1038764582 8:30415284-30415306 CTTTGCTGGTAGCCTGAAATAGG - Intronic
1058988169 9:110228761-110228783 CTTGGATGGTAGCCTGAGTTGGG + Intergenic
1203490228 Un_GL000224v1:97692-97714 CTGGGCTTCTAGCCAGAATCTGG - Intergenic
1203502851 Un_KI270741v1:39575-39597 CTGGGCTTCTAGCCAGAATCTGG - Intergenic
1192167558 X:68835255-68835277 CTCAGCAGGAAGCCTGAAGCAGG - Intronic