ID: 1088777667

View in Genome Browser
Species Human (GRCh38)
Location 11:113101031-113101053
Sequence CCTTGTCCCCAGAAGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088777663_1088777667 -2 Left 1088777663 11:113101010-113101032 CCTCCTGTTCTGCTCAGTTCTCC 0: 1
1: 0
2: 1
3: 23
4: 311
Right 1088777667 11:113101031-113101053 CCTTGTCCCCAGAAGGAGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 266
1088777664_1088777667 -5 Left 1088777664 11:113101013-113101035 CCTGTTCTGCTCAGTTCTCCTTG 0: 1
1: 0
2: 1
3: 19
4: 281
Right 1088777667 11:113101031-113101053 CCTTGTCCCCAGAAGGAGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088777667 Original CRISPR CCTTGTCCCCAGAAGGAGCC TGG Intronic
900475014 1:2872044-2872066 CCTCATCCCCAGAAGGCCCCTGG - Intergenic
900568580 1:3347375-3347397 CATTGGCCCAGGAAGGAGCCCGG + Intronic
902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG + Intronic
902387361 1:16083488-16083510 CCTTGGCCCCAGGAGGGGCTGGG + Intergenic
902561037 1:17277698-17277720 CTCTGCCCCCAGCAGGAGCCTGG + Intronic
903888707 1:26555838-26555860 CCTTGTCCCCAGAGGGAGTAGGG - Intronic
904009796 1:27383065-27383087 CCGTCTCCCCAGGAGCAGCCTGG - Intronic
905940728 1:41861171-41861193 CATGGTCCCCAGATGGAGCATGG - Intronic
906038214 1:42766458-42766480 TCCTCTCCCCAGAAGGACCCCGG + Intronic
907412197 1:54290607-54290629 TCCAGTCCCCAGAAGAAGCCGGG - Intronic
907494911 1:54837232-54837254 CCATGTCCCCATAGGTAGCCTGG + Intronic
909303069 1:74038110-74038132 GCTTTTCCCCTGATGGAGCCAGG + Intronic
911062541 1:93760695-93760717 GCCTGCCCACAGAAGGAGCCTGG - Intronic
911256783 1:95642339-95642361 CCTTGTCTCTAGAAGGAGACAGG - Intergenic
912747731 1:112259384-112259406 CTCTCTCTCCAGAAGGAGCCAGG - Intergenic
913529300 1:119722160-119722182 CCTTGGACCCAGAGGCAGCCAGG + Intronic
915938828 1:160105534-160105556 TATTGTCCTCAGAAGGAGCTGGG + Intergenic
916056553 1:161072613-161072635 CCATGTCAACAGAAGGAGCCAGG + Exonic
916100342 1:161388837-161388859 CCTTGTGGCCAGAAGAAGCTAGG + Intergenic
917079052 1:171237645-171237667 GCTTGTCCCCTGCTGGAGCCAGG + Intergenic
917099078 1:171427790-171427812 CTTTTTCCCCAGAAACAGCCAGG + Intergenic
917836187 1:178943262-178943284 CCTTTTCCCGAGAAGGTACCAGG + Intergenic
919845522 1:201639801-201639823 CCATGTCCCCAGCTGGAGGCCGG - Intronic
920030212 1:203033034-203033056 CCGTGTCCCCTGAATGAGCCTGG + Intronic
920088994 1:203438928-203438950 CCCATTCCCAAGAAGGAGCCTGG - Intergenic
920925588 1:210338333-210338355 CCTTGTTTCAAAAAGGAGCCTGG + Intronic
921221010 1:212974011-212974033 CCTGTCCCCCAGAAGGAGACAGG + Exonic
922728966 1:227940229-227940251 CCTGGACCCCAGAAGGGGCATGG + Intronic
1062901358 10:1149078-1149100 CATTCTCTCCAGAAGGAGGCTGG - Intergenic
1062972423 10:1659491-1659513 CCTCTTCCCTGGAAGGAGCCTGG + Intronic
1063250748 10:4271346-4271368 CCTTGGTCCCAGAAGAAGACAGG + Intergenic
1064951339 10:20854422-20854444 AATAGTCCCCAGAGGGAGCCTGG + Intronic
1067226034 10:44376293-44376315 CCTTGTCCCCAGTGGGAATCAGG - Intronic
1067251349 10:44589449-44589471 GCTTGTCACCAGAAGGACTCGGG + Intergenic
1071298587 10:84240260-84240282 TCCTGTCCCCAGTAGAAGCCAGG - Intronic
1072278165 10:93842720-93842742 ACTTGCCCCCAGGAGGTGCCTGG - Intergenic
1072533995 10:96345946-96345968 GCTTGTGCCCAGACTGAGCCTGG - Exonic
1072610507 10:97014449-97014471 CTTTGTGCCAAGGAGGAGCCAGG - Intronic
1073083767 10:100875514-100875536 ACTTGTCACCAGGAGGAGCAAGG + Intergenic
1073540639 10:104314311-104314333 CCTTGTCCCCAGAACAGGGCTGG + Exonic
1074713903 10:116200864-116200886 CTTTCTCCCCAGAATGATCCTGG - Intronic
1075059798 10:119248125-119248147 CCTTGGCCTCTGAAGGAGCTGGG + Intronic
1075172758 10:120131236-120131258 CCTGGACCCCACAAGAAGCCCGG - Intergenic
1075404073 10:122182951-122182973 CCTTGGCCTCCGAAAGAGCCAGG - Intronic
1075481968 10:122789734-122789756 CTCTGTCCCCAGCAGGGGCCTGG + Intergenic
1075587994 10:123671172-123671194 CCTTCTCTCCACAAGGGGCCAGG - Intronic
1075602768 10:123782696-123782718 TCTTGTCCACAGAAGGAAGCAGG - Intronic
1076224374 10:128762232-128762254 CCTGGCCCCCAGAAGCAGGCAGG + Intergenic
1076819489 10:132931394-132931416 CCTCCTCCCCAAAAAGAGCCTGG + Intronic
1076819649 10:132931968-132931990 CCTTGTCGCCACACAGAGCCTGG + Intronic
1076819771 10:132932422-132932444 CCTTGTCGCCACACAGAGCCTGG + Intronic
1076835934 10:133020930-133020952 CCTTCTCCCCTGAAGGAGTCAGG + Intergenic
1076881225 10:133240124-133240146 CAGAGACCCCAGAAGGAGCCAGG - Exonic
1077266452 11:1653168-1653190 CCTTGTCCCCTGAAGCACACAGG + Intergenic
1078904543 11:15671703-15671725 CCTCCTCCCCAGAAGGTCCCAGG - Intergenic
1083234588 11:61343496-61343518 CCTTGTAACTGGAAGGAGCCAGG + Intronic
1085442080 11:76574667-76574689 CCCTGTCCCCACGATGAGCCTGG - Intergenic
1088777667 11:113101031-113101053 CCTTGTCCCCAGAAGGAGCCTGG + Intronic
1089299159 11:117488085-117488107 CCTTGTCCTCAGTAAGAGGCAGG + Intronic
1089750660 11:120648976-120648998 CCTTGGCCCCCGAGGGAGCCTGG + Intronic
1089864595 11:121620620-121620642 CCCTATACCCAGAAGCAGCCTGG + Intronic
1089916703 11:122164191-122164213 CCTTGTAGCGAGAGGGAGCCTGG - Intergenic
1091875579 12:3930629-3930651 CCTTTCCCCCAGGAGGAGCCTGG - Intergenic
1092094081 12:5827597-5827619 CCTTGGCCCCAGGAGCAGCGGGG - Intronic
1093158352 12:15715210-15715232 CCTTGTCCCCAGTTGGAGAAAGG - Intronic
1093522482 12:20067051-20067073 CCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1094169316 12:27475455-27475477 CCTTGTCACCAAAATGGGCCAGG - Intronic
1095103528 12:38205560-38205582 CCTGTTCCCCAGATGGAACCAGG - Intergenic
1097048312 12:56204624-56204646 CCTTACCCTCAGATGGAGCCAGG - Exonic
1098750970 12:74292913-74292935 CAGAGACCCCAGAAGGAGCCGGG - Intergenic
1101603552 12:106231280-106231302 CCTTGGCCTCAGGAGCAGCCTGG - Intergenic
1101889874 12:108703738-108703760 CCCTCTCCCCAGCAGAAGCCAGG + Intronic
1102465064 12:113125009-113125031 CCTTGGCCCCACAAGGTGCCGGG - Intronic
1102672394 12:114631198-114631220 TGGTGTCCCCAGAAGCAGCCAGG - Intergenic
1102698477 12:114818133-114818155 CCTTCTACCAAGAAGGTGCCCGG - Intergenic
1103084538 12:118052372-118052394 CCTTCTCCCCAGATGGCTCCTGG - Exonic
1103200154 12:119081643-119081665 CCTGTTCCCCAGAAGGCGGCTGG - Intronic
1103889460 12:124227879-124227901 CCTTGTCCCCACCAGAGGCCGGG - Intronic
1105696608 13:22895654-22895676 TTTTGCCCCCAGAAGGAGTCTGG - Intergenic
1112495762 13:99903182-99903204 CCATGTCTCCAGAACTAGCCAGG - Intergenic
1113825321 13:113247996-113248018 CCGTGTCCCCATCAGGATCCTGG + Intronic
1114085231 14:19233354-19233376 CCTGGTTCCCATATGGAGCCTGG + Intergenic
1114405537 14:22452860-22452882 CCCCTTCCCCAGGAGGAGCCAGG + Intergenic
1114850093 14:26373352-26373374 TCTTATTCCAAGAAGGAGCCTGG + Intergenic
1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG + Intronic
1116139229 14:40968434-40968456 CTTTGTCCCCAGATAGAGGCGGG + Intergenic
1117556545 14:56891852-56891874 CCTTGTCCCAAGAAGTCCCCTGG - Intergenic
1117590715 14:57265470-57265492 CCTTGGCCCCACAAGGTGCTGGG - Intronic
1121343304 14:93117381-93117403 CCATGTCCCCCCCAGGAGCCAGG - Intergenic
1121865514 14:97359131-97359153 CTTTGTACCCAGAAGGACCTGGG - Intergenic
1122602404 14:102928309-102928331 CCCTGTGCACGGAAGGAGCCCGG - Intronic
1122638100 14:103139492-103139514 CCCTGTCCCTGGAAGCAGCCTGG - Intergenic
1122800380 14:104226395-104226417 CCGTATACCCAGAAGGACCCTGG - Intergenic
1124634092 15:31353900-31353922 CTTTTTCCCCAGAAGCAGCCTGG - Intronic
1125973995 15:43935227-43935249 CCTTGTCCCCCGAAAGGGCTGGG - Intronic
1126099424 15:45110856-45110878 GCCTGTCCCCACAAGGAACCAGG + Intronic
1126104105 15:45136181-45136203 GCCTGTCCCCACAAGGAACCAGG - Intronic
1126691715 15:51293807-51293829 CCTTGGCCTCACAAGGTGCCGGG + Intronic
1127023345 15:54775702-54775724 CCCTGTCCCCAGCAGCAGCTGGG + Intergenic
1129540200 15:76342228-76342250 CCTTTTCCCCGCTAGGAGCCCGG - Exonic
1132522941 16:399759-399781 CCTTGCCCCCAGCAGCAGCCTGG - Intronic
1133015250 16:2936747-2936769 CTTTGTCCCCAGAGGGCCCCGGG + Intronic
1133954291 16:10426966-10426988 CCTTGTCCTCCCAAGTAGCCGGG + Intronic
1135187745 16:20329773-20329795 CCTTGCCCCCACAAAGTGCCAGG + Intergenic
1135526717 16:23218746-23218768 CCTTGTCCCTAGATGGGGACGGG + Intergenic
1137707707 16:50547501-50547523 CAGTGTCCCCAGAAGGGGGCAGG + Intergenic
1137729806 16:50681096-50681118 CCCTGCCCCCAGCAGGTGCCAGG + Intronic
1137793688 16:51196689-51196711 CCTTCTGCCGAGAAGAAGCCAGG + Intergenic
1138203257 16:55105657-55105679 ACATGTGCCCAGAGGGAGCCAGG + Intergenic
1138234869 16:55373781-55373803 AGTTGATCCCAGAAGGAGCCAGG + Intergenic
1138559257 16:57790701-57790723 CCAAGTCCCCAGAAGGTGCCTGG + Intronic
1139139917 16:64248865-64248887 ACTTGTCCTCAGCAGGAGCTTGG + Intergenic
1142123597 16:88399312-88399334 CCTTGTCCCCAGAACCTGGCTGG - Intergenic
1142200398 16:88758353-88758375 CCTTGGCCCCAGCAGTGGCCTGG + Intronic
1142866488 17:2794564-2794586 GCTAGTCCCCAGCAGGAGCCCGG - Intronic
1143011644 17:3869398-3869420 CTCTGTCCCCCCAAGGAGCCAGG + Intronic
1144766895 17:17737977-17737999 CCCTGGCCCCAGAAGGAGGGAGG + Intronic
1144854443 17:18260310-18260332 CCTGGTCCCCAGAAGGAACGGGG + Intergenic
1145403973 17:22569868-22569890 CCTTGTCCCCAGAGGCATACGGG + Intergenic
1146076804 17:29738080-29738102 CCGTGACCCCACAAGGGGCCCGG + Intronic
1146721806 17:35129303-35129325 CCTGGGCCCCAGCAGGAGCAGGG + Intronic
1146763291 17:35496577-35496599 CCTTCTCCCTGGAAGGAGCGGGG + Intronic
1147137435 17:38442347-38442369 CCCTGTCCCCAGGAGGGGTCTGG - Intronic
1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG + Intronic
1147714146 17:42492763-42492785 CCTTGTCCCCACAAAGTGCTGGG - Intronic
1148782294 17:50129177-50129199 CCTTCTCCCCAGTCAGAGCCCGG + Intronic
1149242181 17:54663344-54663366 ACTTTTCCCCTGCAGGAGCCAGG - Intergenic
1150137680 17:62704415-62704437 TCTTTTCCACAAAAGGAGCCCGG - Intronic
1150625485 17:66838465-66838487 TCTCCTCCCCACAAGGAGCCTGG - Intronic
1152040099 17:77897417-77897439 CCTTGTACCCGGAATGGGCCAGG - Intergenic
1152264983 17:79288915-79288937 CTCTGTCCCCAACAGGAGCCAGG - Intronic
1152422021 17:80198620-80198642 CACTGTCCCCATGAGGAGCCCGG - Intronic
1157555022 18:48607767-48607789 CCCTGTCCCTAGGAGGAGCTTGG + Intronic
1157722017 18:49932359-49932381 GCTGGTCCCCAGAAGGCACCTGG + Intronic
1158039889 18:53080308-53080330 CCATCTCCACAGAAAGAGCCTGG + Intronic
1159973089 18:74677339-74677361 CCTTGGCCTCAGAAGGTGCTGGG + Intronic
1160108685 18:76004673-76004695 CCTTCTCACCAGGAGGATCCTGG + Intergenic
1161078476 19:2298480-2298502 CCTTGGCCTCCGAAGGTGCCGGG + Intronic
1161723923 19:5917800-5917822 CGGTGGCCCCTGAAGGAGCCAGG + Exonic
1162064843 19:8119123-8119145 CCTTCACCCCAGCGGGAGCCAGG + Intronic
1162338631 19:10077866-10077888 CCTTGGCCCCCCAAGGAGCTGGG + Intergenic
1162935637 19:13980230-13980252 AATCCTCCCCAGAAGGAGCCAGG + Intronic
1163030845 19:14543162-14543184 GCTTCTCCCCACAAGGAGCCTGG - Intronic
1164973308 19:32550847-32550869 CGTTGTCCACAGAGGGTGCCAGG - Intergenic
1165854472 19:38871277-38871299 CCTGGTCCCCTCAAGGCGCCAGG + Intronic
1165922432 19:39307491-39307513 CCTTGTCCCCGGGAGGGGGCGGG - Exonic
1166373291 19:42314001-42314023 CTTTCTCCCCAGAAAGATCCCGG + Intronic
1166749856 19:45159545-45159567 CCTTGTCCCCAGCTCGGGCCAGG + Intronic
1166773612 19:45299306-45299328 CCTTGGCCCCTGAAGTAGCTGGG - Intronic
1167747776 19:51362926-51362948 GCTTGTCCCCAGAGGGAAGCTGG - Intronic
925433204 2:3814887-3814909 GCTTTTCCCCTGATGGAGCCAGG - Intronic
926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG + Intronic
927126724 2:20019068-20019090 CTTCTTCCCTAGAAGGAGCCTGG - Intergenic
927460421 2:23293944-23293966 CCTTGTTCTCAGAAGGAGAAAGG - Intergenic
927847609 2:26479587-26479609 CCTCGGCCCCGGAAGGAGCCGGG - Exonic
934550843 2:95260649-95260671 TCTTGTCCCCAGAGGGAGAGAGG - Intergenic
934575989 2:95401983-95402005 ACTTGTCCCACGAAGGAGTCTGG - Intergenic
934638162 2:96009840-96009862 ACTTGTCCCACGAAGGAGTCTGG - Intergenic
934683440 2:96303158-96303180 CCTGGTCCCCAAGAGCAGCCTGG + Exonic
935140897 2:100352007-100352029 CCTTATTCCCAGATGCAGCCCGG - Intergenic
935734406 2:106095634-106095656 CCCTGTGTCCAGCAGGAGCCCGG - Intronic
935760459 2:106315866-106315888 CCCTGACCTCAGCAGGAGCCAGG - Intergenic
936047886 2:109200972-109200994 CTTTGTCCCCAGCAGCAGCCCGG - Intronic
936098691 2:109555328-109555350 CATTGTTCCCAGAACGAACCTGG + Intronic
936151834 2:110025980-110026002 CCTTCTGCACAGAAGTAGCCAGG + Intergenic
936192840 2:110345389-110345411 CCTTCTGCACAGAAGTAGCCAGG - Intergenic
937094086 2:119224392-119224414 CTTGGTCCCCAGGAGGAGGCTGG + Intronic
937883757 2:126886559-126886581 CCTCTTCCCCAGAAGGAACGGGG + Intergenic
938370261 2:130763987-130764009 CCCTGCTCCCAGAAGGAGCCTGG + Exonic
939181654 2:138810096-138810118 TCCTGGCCACAGAAGGAGCCAGG - Intergenic
941352794 2:164456798-164456820 CATTGTGCCCAGATGCAGCCTGG + Intergenic
943101639 2:183493941-183493963 CCTGGTCCCCAAAAGGACCGTGG - Intergenic
944913998 2:204338915-204338937 TCTTATCCCCAGCAGAAGCCTGG + Intergenic
948270571 2:236670365-236670387 CCCTGCACCCACAAGGAGCCTGG + Intergenic
948399731 2:237674951-237674973 CCCTGCCCCCAGAGAGAGCCTGG + Intronic
948615362 2:239195029-239195051 CCTTCTGCTGAGAAGGAGCCTGG + Intronic
1169709116 20:8541427-8541449 CCATGTGCCCAGAAGGAGAATGG - Intronic
1170103658 20:12729778-12729800 TCATGTCCCCACAAGGAGGCAGG - Intergenic
1172481376 20:35273882-35273904 CCTTGGCTCAAGCAGGAGCCAGG + Intronic
1172822438 20:37749357-37749379 TCTTCTCCCCGGCAGGAGCCAGG - Intronic
1174296883 20:49552041-49552063 GTTTCTCCCCAGAAGGAGTCTGG - Intronic
1174671356 20:52310796-52310818 ACTTGTGCTCAGAAGGACCCCGG - Intergenic
1175368202 20:58469814-58469836 CCTTGACCCCAGAATGGGACTGG + Intronic
1175397360 20:58675547-58675569 CCTCGTCCCCAGATTGAGCTTGG + Intronic
1175898542 20:62350959-62350981 GCTTCTCCGCAGAATGAGCCCGG + Intronic
1176164406 20:63665189-63665211 GCCTGTCCCCAGGAGGTGCCAGG - Intronic
1176285273 21:5016067-5016089 CCTGGTTCCCAGAAGGAGGCTGG + Intergenic
1177319055 21:19496148-19496170 CCTTTACCCCATAAGGAGCATGG + Intergenic
1178474842 21:32928743-32928765 GCTTGCCCCCAGATGGAGCTTGG - Intergenic
1179827153 21:43972539-43972561 TCTAGACCCCAGGAGGAGCCTGG + Intronic
1179871908 21:44247408-44247430 CCTGGTTCCCAGAAGGAGGCTGG - Intronic
1180162051 21:46002463-46002485 CCTTGTCCCCAGAAAGACGAGGG + Intronic
1180292741 22:10859839-10859861 CCTGGTTCCCATATGGAGCCTGG - Intergenic
1180495547 22:15889261-15889283 CCTGGTTCCCATATGGAGCCTGG - Intergenic
1181032920 22:20156941-20156963 CCTAGTCCCCAGCAGGTGCTGGG - Intergenic
1181809618 22:25395457-25395479 CTTGGTTCCCAAAAGGAGCCTGG - Intronic
1182472315 22:30556086-30556108 CTCTGTCCCCAGCAGGACCCCGG - Exonic
1183714774 22:39527245-39527267 CCTTTTCCCCACAAGCAGCTGGG + Intergenic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184797707 22:46741428-46741450 CCTGGCCACCAGCAGGAGCCTGG + Intergenic
1184902678 22:47457403-47457425 CCTTGCACCCAGTCGGAGCCAGG + Intergenic
1185252575 22:49812779-49812801 CCTTGTCTCCAGAATGGTCCTGG - Intronic
1185252586 22:49812841-49812863 CCTTGTCTCCAGAACGGTCCTGG - Intronic
1185252598 22:49812904-49812926 CCTTGTCTCCAGAATGGTCCTGG - Intronic
951891998 3:27576102-27576124 CCTGGTCACCAGAAGGAACAAGG - Intergenic
956665750 3:71640637-71640659 CCTTCTCCACAGAAGGTTCCAGG - Intergenic
957041974 3:75342567-75342589 CCTTGTCGCCAGAAGGCTCTGGG - Intergenic
959536602 3:107493365-107493387 CCATGTGCCCAGGAGAAGCCTGG - Intergenic
959553181 3:107687472-107687494 CCTTATCTCCAGCAGGGGCCAGG - Intronic
961155576 3:124676734-124676756 AGTTGTTCTCAGAAGGAGCCAGG + Intronic
961335767 3:126179083-126179105 CTTTGGCCCCAGAAAGAGCAGGG + Intronic
961666125 3:128493962-128493984 CCTCATCCCCAGAAGGCCCCTGG + Intergenic
962968655 3:140378682-140378704 CCTTGTACTCAGAAAGAGCATGG + Intronic
967135654 3:186510618-186510640 CCATGTCCCCAGAATAAACCAGG - Intergenic
967955053 3:194871687-194871709 CAGTGTCCTCAGCAGGAGCCCGG - Intergenic
968516491 4:1017777-1017799 CCTTGCTCCCTGTAGGAGCCAGG + Intronic
968618150 4:1591627-1591649 CCATGTGCTCAGAAGGAACCAGG - Intergenic
969449195 4:7263476-7263498 CATTGTCCTGGGAAGGAGCCGGG + Intronic
969509658 4:7610533-7610555 CCTTGTCTCAAGAAACAGCCGGG + Intronic
971073487 4:23122046-23122068 CCTTGCCCTCAGTAGGACCCTGG - Intergenic
972458642 4:39278680-39278702 CCTTGCGCCCAGAAGGTGCGTGG - Intronic
974229595 4:59092207-59092229 CCTTTTCCCCAGAAGCTCCCAGG + Intergenic
978270054 4:106878066-106878088 CCTTGTCCATAGAAAGGGCCTGG - Intergenic
978421699 4:108540654-108540676 CCTTGGCCCCACAAGTTGCCTGG + Intergenic
981540274 4:145839245-145839267 CCTTGTCCCGAGAAGTTTCCGGG - Intronic
986964299 5:13251964-13251986 TCTTGTCCCAGGAATGAGCCTGG + Intergenic
987155128 5:15081552-15081574 ATTTGCACCCAGAAGGAGCCTGG - Intergenic
990343558 5:54849195-54849217 CCTGGCCCCCAGAAGGAAGCAGG - Intergenic
992654600 5:78895986-78896008 CCTCATCCCCTGGAGGAGCCGGG + Intronic
992915637 5:81450144-81450166 CCTTGGCCCCACAAGTAGCTGGG + Intronic
993598094 5:89884763-89884785 CCTTCTCCACAGAAGCAGCATGG + Intergenic
997253347 5:132408532-132408554 CCTTCTCCCTAGATGGGGCCTGG - Intergenic
997659130 5:135576684-135576706 CCTTGCACCCAGAAGGATCCAGG - Intronic
998344800 5:141452446-141452468 CCTTGTCAGCAGACGGAGCTAGG + Intronic
998350378 5:141496492-141496514 CCTTGTTGCCACAAGGACCCAGG + Intronic
1001616392 5:173046654-173046676 CCTTGTCCCCACAAAGTGCTGGG + Intergenic
1002810431 6:623021-623043 CCTCATCCTCAGAAGGAGCAGGG + Intronic
1003520796 6:6856881-6856903 CCTGGCCCCCAGATGAAGCCTGG + Intergenic
1005894073 6:30163366-30163388 CCTAGGGACCAGAAGGAGCCAGG + Exonic
1005989870 6:30896156-30896178 GCTTGGCCCCAGGGGGAGCCAGG + Intronic
1010438489 6:75863959-75863981 CCTTGTACCCAGAAAGAGCCTGG + Intronic
1010730773 6:79388847-79388869 CTTTGCCTCCAGAAAGAGCCTGG - Intergenic
1015673983 6:135724249-135724271 CCTTGTATCCAGAAGCAACCAGG + Intergenic
1016181833 6:141156213-141156235 CCTTGGCCCCACAAAGAGCTGGG - Intergenic
1017764211 6:157593539-157593561 TCCTGTCCCCAGAAGGAGTGGGG - Intronic
1018163527 6:161071462-161071484 CCTTGTCCCCAAAAGAAGAAAGG + Intronic
1019210601 6:170401542-170401564 CGCTGTCCCCTGCAGGAGCCAGG + Intronic
1019732601 7:2636174-2636196 CCTTGTGCCCAGTTGCAGCCTGG + Intronic
1020001214 7:4757042-4757064 CCACGTTCCCAGGAGGAGCCTGG + Exonic
1022247196 7:28571717-28571739 CCTTATCCCCAGAATGAGGATGG + Intronic
1027193282 7:76010542-76010564 CCTCAGCCCCAGAAGGAGCCAGG + Intronic
1028177555 7:87675117-87675139 CCTTTTCCCCAGAAGATGCTGGG + Intronic
1029438211 7:100574101-100574123 CCTCGACCCCAGAGGCAGCCAGG + Intronic
1030771086 7:113475616-113475638 CCTTGCCCAGAGAGGGAGCCTGG + Intergenic
1032862716 7:135895952-135895974 ACATGCCCCCAGAAAGAGCCAGG + Intergenic
1032863335 7:135902387-135902409 CCTTTTACCCAGAAAGAGGCAGG - Intergenic
1033449466 7:141449655-141449677 TCTGGTACCCAGAGGGAGCCAGG - Intronic
1033602083 7:142895755-142895777 CCTTGTCTACAAAAGGAGCACGG + Intergenic
1034429149 7:151032229-151032251 CCTTCTCCTCAGAGGGAGTCAGG - Intronic
1034755752 7:153617672-153617694 GCTTGTTGCCAGAAGGATCCAGG + Intergenic
1034854171 7:154524959-154524981 CATTCTCCCCAAAATGAGCCAGG - Intronic
1035844286 8:2846445-2846467 CCTTCTCCCCTAAGGGAGCCGGG - Intergenic
1036587603 8:10138929-10138951 CCTTGTCCCCAGAAATACACAGG + Intronic
1037145678 8:15569519-15569541 GCTTATGGCCAGAAGGAGCCAGG + Intronic
1037899217 8:22677802-22677824 TCTTGTCCCCAGAGGGAATCTGG + Intergenic
1041195977 8:55401668-55401690 CTTTGGCCCCAGATGGACCCAGG - Intronic
1041628749 8:60061179-60061201 CCATGTGCCCACAACGAGCCAGG - Intergenic
1042894512 8:73651605-73651627 CAGAGACCCCAGAAGGAGCCAGG - Intronic
1048215540 8:132490820-132490842 CCTGGACCCCAGAATGAGACAGG + Intergenic
1048441045 8:134459118-134459140 CCTTGTCCCCAGGAACTGCCAGG + Intergenic
1049035362 8:140071391-140071413 CCTTGCCCACAGAAGAAGCCTGG - Intronic
1049355505 8:142186344-142186366 CCATGCCCCCAGCAGGAGCATGG + Intergenic
1049375808 8:142288534-142288556 CCTTCTGCCCAGGAGGACCCGGG - Intronic
1051418842 9:16870917-16870939 TTTTGTCCCGAGGAGGAGCCGGG - Intergenic
1053429428 9:38032408-38032430 CCTGTTGCCCAGAAGGAGCCTGG - Intronic
1055552708 9:77446039-77446061 CCTTTTCCCCAGCAGGGCCCTGG - Intronic
1056503998 9:87239372-87239394 CCTTGTTCACAGAAGGAGTAGGG + Intergenic
1058882511 9:109297741-109297763 CCTTGGCCCAAGAAGCATCCAGG - Intronic
1060225217 9:121786273-121786295 CCTTGCCCCCAGCAGAAGCTCGG - Intergenic
1061076556 9:128345004-128345026 GCATGTTCCCAGCAGGAGCCAGG + Intronic
1061125922 9:128675690-128675712 TCTGGTTCCCAGAGGGAGCCTGG + Intergenic
1061451056 9:130667159-130667181 CCCTGGCCCCGGAAGCAGCCTGG + Intronic
1061800978 9:133113292-133113314 CCTCAACCCCAGCAGGAGCCAGG + Intronic
1062033865 9:134374140-134374162 CCTTGTCCCCAGAAAGGGGATGG - Intronic
1062610038 9:137369498-137369520 CCTGGTCCCAAGGAGGTGCCGGG - Intronic
1185444932 X:252879-252901 CCTTGTCCCGATAAGCACCCAGG - Intergenic
1188141611 X:26558134-26558156 CAGAGACCCCAGAAGGAGCCAGG - Intergenic
1189166972 X:38870067-38870089 CCTACTCCCCAGAAGCAGCCTGG - Intergenic
1192807362 X:74522518-74522540 GCTCCTCCCCACAAGGAGCCAGG - Intronic
1195206319 X:102602863-102602885 CCTTGCCTCCAGAAGGAAACTGG + Exonic
1197703119 X:129614889-129614911 CCCTGTCCCCAGGAGGGGCATGG - Intergenic
1198450292 X:136760453-136760475 TGTTGTCCCCAGAAACAGCCTGG + Intronic
1200144361 X:153918909-153918931 CTTTGTCCCCTGGAGGATCCAGG + Exonic