ID: 1088779065

View in Genome Browser
Species Human (GRCh38)
Location 11:113116327-113116349
Sequence CTCTTTCCCTTCTATAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088779065_1088779070 -7 Left 1088779065 11:113116327-113116349 CCTTCATTATAGAAGGGAAAGAG 0: 1
1: 0
2: 4
3: 22
4: 238
Right 1088779070 11:113116343-113116365 GAAAGAGAAGGGTGGTGGACTGG 0: 1
1: 0
2: 3
3: 60
4: 567
1088779065_1088779071 3 Left 1088779065 11:113116327-113116349 CCTTCATTATAGAAGGGAAAGAG 0: 1
1: 0
2: 4
3: 22
4: 238
Right 1088779071 11:113116353-113116375 GGTGGTGGACTGGTAGTGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 163
1088779065_1088779073 12 Left 1088779065 11:113116327-113116349 CCTTCATTATAGAAGGGAAAGAG 0: 1
1: 0
2: 4
3: 22
4: 238
Right 1088779073 11:113116362-113116384 CTGGTAGTGCCAGGGCTCTGAGG 0: 1
1: 0
2: 3
3: 32
4: 338
1088779065_1088779072 4 Left 1088779065 11:113116327-113116349 CCTTCATTATAGAAGGGAAAGAG 0: 1
1: 0
2: 4
3: 22
4: 238
Right 1088779072 11:113116354-113116376 GTGGTGGACTGGTAGTGCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088779065 Original CRISPR CTCTTTCCCTTCTATAATGA AGG (reversed) Intronic
902623248 1:17662613-17662635 CTCTTTCCCATCTATAAAACAGG - Intronic
902773269 1:18658501-18658523 CACTTTCCCTTCCATCATGTGGG - Intronic
903099193 1:21013447-21013469 CTCTTTTCCTTCTGTCATGATGG - Intronic
904881551 1:33701250-33701272 CCCCTTCCCTCCTAAAATGAGGG + Intronic
907890642 1:58633191-58633213 CTGTTTCCAAACTATAATGATGG - Intergenic
907937273 1:59053501-59053523 TTGATTCCCTTTTATAATGATGG - Intergenic
908395986 1:63726120-63726142 TTGTTTCCCTTGTAGAATGAAGG + Intergenic
908587301 1:65584078-65584100 TTCTTTCCTTTCTATCAGGATGG + Intronic
909126451 1:71677141-71677163 TTGTTGGCCTTCTATAATGATGG + Intronic
909136748 1:71810791-71810813 CTCTTTGCCTTCCACCATGATGG + Intronic
909468597 1:76001680-76001702 CTCCTTGCCTTCCATCATGATGG + Intergenic
909618439 1:77639486-77639508 CTCTTTTCCTTATATCCTGAAGG + Exonic
911165702 1:94722547-94722569 TTCTTTCCCTTCCATAGTCATGG + Intergenic
911567092 1:99475067-99475089 CTCTTTCCCCTTTATAAAGAAGG - Intergenic
911763312 1:101641768-101641790 CTATTTTCCTTCTAGAATGCTGG + Intergenic
913520856 1:119644970-119644992 CTGTTTCCATTCAATTATGAAGG - Intronic
914003711 1:143714808-143714830 CAGTTTCCCTTCTATATTAATGG - Intergenic
916142553 1:161712050-161712072 CTCTTCTCCTTCTACAAGGATGG + Exonic
919988774 1:202694346-202694368 CTTTTTCCCTTCAATATTGAGGG + Intronic
920163850 1:204021074-204021096 CTTTTTCACTTATATAATGCTGG + Intergenic
920762798 1:208801980-208802002 CTCTTTCCATTCATTAATCAAGG - Intergenic
922465819 1:225845131-225845153 CTCTTTCACTTCCAGGATGAAGG + Exonic
922553106 1:226511714-226511736 CTCCTTCCCTACTAGAAGGAAGG - Intergenic
924019329 1:239764360-239764382 CTCTTTTCCTTCTGTTCTGATGG - Intronic
924654790 1:245964091-245964113 CTCTTTGCCTTCTGCCATGATGG - Intronic
924730846 1:246710346-246710368 CTCTTCACCTTCTACCATGAGGG - Intergenic
924730859 1:246710400-246710422 CTCTTTGCCTTCCACCATGATGG - Intergenic
1062917566 10:1253553-1253575 CTCTTTCCCTTGAATAAGGTAGG - Intronic
1063843078 10:10093343-10093365 CTCTTTCCTTTAAATAATCATGG + Intergenic
1068324171 10:55461998-55462020 CTCTTTCACAGCCATAATGAAGG - Intronic
1069075444 10:64034082-64034104 CTCATTCTCTTCTCTAGTGAGGG + Intergenic
1071012077 10:80951099-80951121 CTCTTTCTCTACTACAATGCTGG - Intergenic
1071685366 10:87749275-87749297 CTCCTTCCCTTCTATCCTAAAGG + Intergenic
1072199653 10:93146746-93146768 CACTTTCCCTTCTGAAATGACGG + Intergenic
1073070060 10:100787672-100787694 CTCTTCTCCTTCAATAATCAGGG - Intronic
1073901580 10:108228566-108228588 CTCCTTCCCTTCTATGATAGTGG + Intergenic
1074841810 10:117360164-117360186 CTCTTTGAATTCTATTATGAGGG - Intronic
1075609885 10:123844241-123844263 CTCTTTCTCTTTAATAATGTAGG + Intronic
1077241195 11:1511214-1511236 CTCTCTCCATTCTAGAATGTGGG - Intergenic
1077633598 11:3827123-3827145 CTCTCTCCCTTCTCCAATGAGGG - Exonic
1079479468 11:20864512-20864534 CTCTTTCCCCTCTTTGATCAAGG - Intronic
1080763169 11:35272256-35272278 CTCCTTCCCTTCTGTATTGATGG - Intronic
1081158676 11:39727214-39727236 CTCTTTCCTCTCTGAAATGAGGG + Intergenic
1081776856 11:45681610-45681632 GTCTTTCACTTCTATCTTGAAGG - Intergenic
1081876845 11:46414385-46414407 CTCTGTCCCTTCTGTAATCATGG - Intronic
1084346866 11:68558161-68558183 CGTTTTCCCTTCTTTAGTGAGGG + Intronic
1084734415 11:71095053-71095075 GCCTTTCCCATCTCTAATGAGGG - Intronic
1084848925 11:71922757-71922779 CTCTTTCCCTTCTGTTATCCTGG - Intronic
1085422628 11:76376877-76376899 TTATTTCACTTCCATAATGAGGG - Intronic
1085440490 11:76558187-76558209 CTCTGCCCCTTCTAGAAAGAGGG + Intergenic
1085782957 11:79425820-79425842 TTCTTTCCCCTCAATAATCATGG - Intronic
1087389338 11:97514231-97514253 CTGTTTCCATTGTATACTGATGG + Intergenic
1088779065 11:113116327-113116349 CTCTTTCCCTTCTATAATGAAGG - Intronic
1088826943 11:113503938-113503960 GTATTTCACTTTTATAATGAAGG + Intergenic
1089667836 11:120031650-120031672 CTCTTTCTCATCCATAATGGTGG + Intergenic
1089864986 11:121623954-121623976 CTCTTTGCCTTCCACCATGATGG - Intronic
1090154641 11:124424773-124424795 CTCTTTTCCTTCTATTCTTAGGG - Exonic
1091946544 12:4550028-4550050 CTCTTTTCTTTCCCTAATGAAGG - Intronic
1092576132 12:9784124-9784146 CTCTTTCCCATGTTTACTGAAGG + Intergenic
1093942429 12:25069077-25069099 AAATTTCCCTTCTATATTGAGGG + Intronic
1098495525 12:71130797-71130819 CTCTTTGCCTAAGATAATGAGGG + Intronic
1099479782 12:83151312-83151334 CTCTTTCCCATCTTTCAAGATGG + Intergenic
1099551443 12:84049279-84049301 CTGTTTTCCTCCTATAATTAGGG + Intergenic
1101723182 12:107368476-107368498 GTCTATCCATTCTTTAATGATGG + Intronic
1103228610 12:119309088-119309110 CTCCTTCCCTTCTATCATCCTGG + Intergenic
1104476411 12:129074088-129074110 ATCTTTCCCATCAATGATGATGG + Exonic
1104571659 12:129931171-129931193 CTCTTTCCTTTCTACATTGTAGG - Intergenic
1105423063 13:20270220-20270242 CTGTTTACTTTCCATAATGAAGG - Intergenic
1107981882 13:45741840-45741862 ATGTTTCTCTTCAATAATGAAGG - Intergenic
1108863442 13:54891728-54891750 CTTTTTCACTTCTTTGATGATGG - Intergenic
1109257416 13:60100123-60100145 GTATTTCCCCTCTATAATTAAGG - Intronic
1109563566 13:64080776-64080798 CTCTTTATATACTATAATGATGG - Intergenic
1109908108 13:68872488-68872510 CTCTTTCCCTCTTAAAAGGAGGG + Intergenic
1110348470 13:74477252-74477274 CTCTTTCCCTTGTATTTTCAAGG + Intergenic
1111144753 13:84166032-84166054 CCCTTTGCCTTCCACAATGATGG - Intergenic
1111812593 13:93110111-93110133 CTCCTTCCCTTCCACCATGATGG + Intergenic
1114775359 14:25475030-25475052 CTCTTTACTTTCTATAACCAAGG + Intergenic
1117733481 14:58746865-58746887 AAATTCCCCTTCTATAATGAGGG - Intergenic
1118015182 14:61653146-61653168 CTCTTTCCCTGCTATATACATGG + Intronic
1119490945 14:75032653-75032675 CACTTTTCCTTATAAAATGACGG - Intronic
1120861299 14:89257178-89257200 CTATTTCCATTCCATCATGAGGG + Intronic
1121481709 14:94282907-94282929 TTCTTTCCTTTGTAAAATGAAGG + Exonic
1126210969 15:46099738-46099760 CTCTTTACCTTCTGCCATGATGG + Intergenic
1126633073 15:50756997-50757019 CTCCTTCCCTTCTACAATACTGG + Intronic
1126921373 15:53529358-53529380 TTCTTTCCTTTATAAAATGAGGG + Intronic
1128805408 15:70527347-70527369 CTCATTACTTTCTACAATGATGG + Intergenic
1129045658 15:72731752-72731774 CTCTCTGCCATCTGTAATGAGGG + Intronic
1133379473 16:5318034-5318056 CTCTTTCACTTCCATGCTGAAGG - Intergenic
1137738802 16:50744466-50744488 CTCTTTGCCATTTATAATTAGGG + Intronic
1139135126 16:64193701-64193723 CTTTTTTCCTTCTTTAATCAGGG + Intergenic
1139321318 16:66116762-66116784 CTCTTGCCCTTGTATATTTATGG + Intergenic
1142513861 17:414179-414201 CTCATTTCCTTTTATGATGATGG - Exonic
1144559164 17:16307494-16307516 CTCTTTCTTTACTATCATGAAGG + Intronic
1149204379 17:54227088-54227110 CTCCTTGCCTTCTACCATGATGG + Intergenic
1149249019 17:54746469-54746491 GTCTTTCCTTTTTATACTGATGG - Intergenic
1150962458 17:69929353-69929375 CTATTTCCTTTACATAATGATGG + Intergenic
1153032412 18:727049-727071 CTCTTTTTCTTCTTTAAAGATGG + Intronic
1153361911 18:4207080-4207102 CTCCTTTTCTTCTATGATGATGG - Intronic
1154369050 18:13741381-13741403 ATCTTTCCCTTGTACAATAAAGG - Intronic
1155397760 18:25404443-25404465 CTCCTGCACTTTTATAATGATGG - Intergenic
1156966750 18:43103764-43103786 CTATTTCAATTCTAAAATGACGG + Intronic
1157019163 18:43758314-43758336 CTCATTTCCTTCTATCCTGATGG + Intergenic
1158390132 18:57038333-57038355 CTCTTTCGCTACTATAAAGCTGG - Intergenic
1159232478 18:65627359-65627381 CTTTTACCCTTCTACAATAACGG - Intergenic
1159918918 18:74210057-74210079 CTCTTTGCCTTCTGCCATGATGG - Intergenic
1162501931 19:11058955-11058977 CTCCTTCCCTTCTGAATTGATGG + Intronic
1167331824 19:48860765-48860787 CTCTTTCCTTTCTTTCTTGACGG - Intronic
1167811838 19:51840110-51840132 CTCTTTCCTTTCTAGCACGATGG - Intergenic
924977985 2:195383-195405 ATCTTTCCATTCTAGAATTAGGG + Intergenic
926418832 2:12677547-12677569 CTCTTTCCCTGTTATAATGAAGG - Intergenic
930486805 2:52020834-52020856 ATCATTCTCTTCTATACTGAGGG + Intergenic
930978855 2:57497404-57497426 TTCTTTCCTTTCTCTAATAAGGG - Intergenic
931331456 2:61289116-61289138 CACTTTCATTTCTTTAATGAAGG + Intronic
932091578 2:68810600-68810622 CCCTTTCTCTTTTCTAATGATGG + Intronic
933083259 2:78021474-78021496 TTCTTTCTCTTATAAAATGATGG + Intergenic
934046889 2:88179772-88179794 CACTTTCCATTTTATAATGAGGG + Intronic
934999289 2:98996645-98996667 CTCCTTCCTTTAGATAATGATGG + Intergenic
936664058 2:114574398-114574420 CTCTTTTCCTTTCATAATGACGG - Intronic
937803299 2:126106002-126106024 CTCATTCTCTTCCATCATGAAGG + Intergenic
938249252 2:129801134-129801156 CTCTTTTCCTTGTATTTTGAAGG + Intergenic
940367876 2:152868939-152868961 CTCTTCCCCTTCTATACTCATGG - Intergenic
940566735 2:155372809-155372831 CTTTTTACCTTCTATCTTGAAGG + Intergenic
941246012 2:163098525-163098547 CTGTTTTCTTTCTATTATGAGGG - Intergenic
941335997 2:164244644-164244666 CTTTTTCTCATCTATAATGCCGG + Intergenic
943974366 2:194452556-194452578 CTGTTTACCTTTTATAAAGAAGG + Intergenic
944386594 2:199171786-199171808 CTCTTTCATTTCTATATTGTTGG + Intergenic
945154334 2:206822762-206822784 CTTTTTCTCATCTAGAATGAAGG + Intergenic
946579234 2:221108388-221108410 CTCCTTCCCTTCTGCCATGATGG - Intergenic
1169308005 20:4510428-4510450 CTGTTTTCCTTCTCTAAGGAAGG + Intergenic
1169436095 20:5592482-5592504 CTCTTTTCTTTGTATAATGGTGG + Intronic
1169447522 20:5684942-5684964 CTCTTTCCCTTCTGCAGTGACGG - Intergenic
1170769988 20:19324260-19324282 AATTTTCCCTTCTCTAATGAGGG - Intronic
1170867030 20:20167027-20167049 CTCTTACACTTCTTTATTGAAGG + Intronic
1174131740 20:48349455-48349477 CTCTTTTTCCTCTAAAATGATGG - Intergenic
1179267595 21:39818423-39818445 ATCTTTCCCTCCCATAGTGAAGG - Intergenic
1179280075 21:39926397-39926419 TCTTTTCCCTTTTATAATGATGG - Intronic
1181839795 22:25647067-25647089 ATCTTTCTCTCCTTTAATGATGG - Intronic
1182805813 22:33069216-33069238 TTATTTCACTTCCATAATGAAGG + Intergenic
1183146228 22:35995047-35995069 CTCTTTCTTTTCTTTCATGAAGG - Intronic
1183824982 22:40379139-40379161 TTCTTTCCCCTCTAGAATGCTGG + Intronic
950311064 3:11958329-11958351 CTCTTCCCCTGCTGTAGTGAAGG - Intergenic
950703733 3:14767362-14767384 CACTTTCCCTTCTCTAATATGGG - Intronic
951766042 3:26200438-26200460 CTCATTTCCTTTTATTATGATGG + Intergenic
951774359 3:26292819-26292841 TTCTTTCATTTCTAAAATGAAGG + Intergenic
952226336 3:31380558-31380580 CTCTTTCCCTTCTCTCTTTATGG - Intergenic
953601956 3:44375360-44375382 TTCTTTCCCTTCTACCATGAGGG - Intronic
955785630 3:62535623-62535645 ATCTTTCCCATCTATAAAGTGGG + Intronic
956945485 3:74217410-74217432 ATCTTTCCCTTCTTTTGTGATGG - Intergenic
958076850 3:88691230-88691252 TCCTTTGCCTTCTATTATGAAGG - Intergenic
959096781 3:101965015-101965037 CTCCTTCCCTCCTATTCTGAAGG + Intergenic
959501649 3:107113673-107113695 CTCTTTTCCTTCCAGAATGAAGG - Intergenic
959737456 3:109676171-109676193 CTCTCTCCCTTCTTTAGTGGGGG + Intergenic
960293551 3:115915429-115915451 CTTTTTCCCATCTATAAAAAAGG - Intronic
960297682 3:115963732-115963754 CTCTATCCATTCTTTAATGTTGG + Intronic
963211038 3:142690537-142690559 TAATTTGCCTTCTATAATGATGG + Intronic
964373227 3:156023378-156023400 CTCCTTCTCTTCTATTGTGATGG - Intergenic
964698520 3:159537140-159537162 CTCTTGCCCTTCTGTGATGAGGG - Intronic
964881341 3:161426521-161426543 CTCTTTACCTTGTATCTTGAAGG - Intergenic
965014829 3:163143781-163143803 ATGTTTCCTTTCTATAATCAAGG - Intergenic
966653452 3:182326963-182326985 CCCTTTCTCTTCTGAAATGATGG + Intergenic
969551660 4:7872613-7872635 GCCTTTTCCTTCTAGAATGATGG + Intronic
971067444 4:23049763-23049785 TTCTTTCCCCTCTAGCATGATGG + Intergenic
973022761 4:45224262-45224284 CTCCTTCCCTTCTATCATGATGG + Intergenic
973208854 4:47592032-47592054 CTCTTTCCCCTTTCCAATGAAGG - Exonic
973692568 4:53452705-53452727 CTGTTCACCTTGTATAATGAAGG + Intronic
973943768 4:55936713-55936735 ATCTTTCACTTCTTTAATTAAGG + Intergenic
974211547 4:58783406-58783428 CTCTTTCCCATCTTTAACAAGGG + Intergenic
975268228 4:72396640-72396662 CTCTTTTCCTTCCATAAAGATGG + Intronic
975432327 4:74308486-74308508 CTCTTATCCTTCTAGACTGACGG - Exonic
976282827 4:83342072-83342094 CTCTTTGCCTTCTGCCATGATGG - Intergenic
976426438 4:84908686-84908708 TTCTTTCCCTTTTAGAATAAAGG + Intronic
978610063 4:110527492-110527514 ATCTTTCCTTTCTAAAATAAAGG - Intronic
980324629 4:131325032-131325054 TTTTTTCCCTTCTACAATGATGG + Intergenic
980581220 4:134754474-134754496 CTCTTACCCATCTGTCATGATGG + Intergenic
981320170 4:143382602-143382624 CTCTTTCACTTTTTGAATGATGG - Intronic
981495074 4:145381896-145381918 TTCTTACCTTTCTAAAATGATGG + Intergenic
981716270 4:147755701-147755723 CTCTTGCCCTTATATAGTGTAGG + Intronic
981812573 4:148792661-148792683 GTCTTTCCCTGCTATAATCAAGG + Intergenic
982997592 4:162369237-162369259 CTACTTCCCTTCTCTAAGGAAGG - Intergenic
984382611 4:179014904-179014926 CTCATTGCCTTATATTATGAGGG + Intergenic
986846858 5:11766059-11766081 CTATTTACCTTCTGTAATAAGGG + Intronic
986856581 5:11875593-11875615 CTCTTCCCCTGCTATACGGACGG - Intronic
987740053 5:21895764-21895786 ATCTTTACCTTCAATCATGAAGG - Intronic
988394322 5:30678348-30678370 CTCCTTGCCTTCCATCATGATGG + Intergenic
989777781 5:45230105-45230127 CTTTTTGCCTTCTGTCATGAGGG + Intergenic
990844304 5:60120527-60120549 CTCTTCCCCTGGGATAATGATGG + Intronic
991419453 5:66426555-66426577 CTCTTTCTCTTCTGTACTTAAGG + Intergenic
993921195 5:93805305-93805327 CTTTTTCCTTTATATAGTGAAGG - Intronic
995367106 5:111374785-111374807 CTATTTCTCTGCTACAATGAAGG + Intronic
996914256 5:128693552-128693574 CCCTTTGCCTTCTGTCATGATGG - Intronic
996928995 5:128863390-128863412 CTGTTTACCTGCTATAATGTGGG + Intronic
998708866 5:144797872-144797894 GTCTTTCCCTCCTATATTGGTGG - Intergenic
998821301 5:146060106-146060128 TTCTTTGTCTTCCATAATGAGGG - Exonic
1000467177 5:161594204-161594226 CTCCTTCCCTTCTGTGATAATGG - Intronic
1000524464 5:162339311-162339333 CTTTTTCCCTTCCACCATGAAGG + Intergenic
1003012102 6:2435758-2435780 CTCTGTCCCTTCTGTCATTAGGG + Intergenic
1003521882 6:6865155-6865177 CTCTTTCATTTCCCTAATGACGG - Intergenic
1004992711 6:21156566-21156588 CTCTTTCCCTTCTTTACAAAAGG - Intronic
1005306400 6:24518127-24518149 CTCTCTCTCTTCTCTAGTGAAGG - Intronic
1008379624 6:50826394-50826416 CTCTTTCTCTTCTCTCATGGTGG - Intronic
1011153422 6:84300836-84300858 CTCTTTGCCTTCTGCCATGATGG + Intergenic
1011227051 6:85119098-85119120 CTCTCTCCCATCTTTTATGACGG + Intergenic
1011296242 6:85829276-85829298 TTATTTCCCTTCTTTTATGAAGG - Intergenic
1011862245 6:91773715-91773737 CTCTTCGCCTTCTCTCATGAGGG + Intergenic
1011901629 6:92304970-92304992 TTCTTGTCCTTCTCTAATGAAGG - Intergenic
1013029100 6:106313174-106313196 CTCTTTCCCTCCTGTTATAATGG - Intronic
1014324584 6:119976709-119976731 CTCTTTCCCTTTTCTAACAACGG + Intergenic
1015206320 6:130643807-130643829 TTCCTACCCTTGTATAATGAAGG + Intergenic
1015513427 6:134061493-134061515 CACTTGCCCTTCTATGCTGAGGG + Intergenic
1016477786 6:144446824-144446846 TTCCTTCCTTTCTAAAATGAGGG + Intronic
1016760664 6:147732973-147732995 CTCAGTCCCTTCTTAAATGAAGG - Intronic
1019981082 7:4622719-4622741 CTCTTTGCCTTCTGCCATGATGG + Intergenic
1022567883 7:31421877-31421899 CTTTTTCCCTTGTAAAATGGTGG + Intergenic
1024340500 7:48253352-48253374 TTTTTTCCCTTGTATACTGAGGG + Intronic
1027728807 7:81843209-81843231 CTCTGTGCCTTCTATAAAGAGGG + Intergenic
1029049372 7:97668569-97668591 TTATTTCCCTTCTAAAATGTAGG - Intergenic
1030750927 7:113231898-113231920 CTCTTTCCCTTCTCTAAATATGG - Intergenic
1031351020 7:120731118-120731140 CACTTTCTCTTCTTTACTGATGG - Intronic
1031390373 7:121206131-121206153 CTCTTTTCCTTTTTAAATGAGGG - Intronic
1032120240 7:129150107-129150129 CTCTTTCCCTCCTGTTTTGAAGG - Intronic
1032248995 7:130236889-130236911 ATCCTTCCCTTCTTTGATGAGGG + Intergenic
1034862660 7:154613057-154613079 CTCTCTCGTTACTATAATGAGGG + Intronic
1036005908 8:4663307-4663329 CTCTTTCCCCTTTAAAAAGATGG - Intronic
1038796194 8:30712254-30712276 TTATTTTCCTTCTGTAATGAGGG + Intronic
1039850970 8:41364643-41364665 CTCTTCCCCTTCCACTATGATGG + Intergenic
1040353790 8:46595554-46595576 TTGTTTCCATCCTATAATGAAGG + Intergenic
1041975399 8:63793875-63793897 CTCTATCCTTTCTATATTCATGG - Intergenic
1042965921 8:74351552-74351574 CTCTTTCTCTTGTGTCATGATGG + Intronic
1043460805 8:80458272-80458294 GTTTTTTCTTTCTATAATGATGG + Intergenic
1043754812 8:83989895-83989917 ATCTTTCCTTTCTATATTTAGGG + Intergenic
1044648635 8:94470962-94470984 AACTTTCCCTTATATAATGTTGG + Intronic
1044837800 8:96313143-96313165 TACTTTCTCTTCTATAAAGATGG + Intronic
1046410042 8:113830227-113830249 CTGATTGCCTTCTATAATGTGGG + Intergenic
1047218076 8:122895172-122895194 CTCTCTCCCTTCTTTAAAGGGGG + Intronic
1048390389 8:133958171-133958193 TTCCTTCCCTTCTAGAATGCAGG + Intergenic
1048793274 8:138124132-138124154 CTCTTTGCCTTCTACAATGTAGG + Intergenic
1050542299 9:6681087-6681109 CTCTTTCCCTTCTATGAAGAAGG + Intergenic
1052582976 9:30384995-30385017 CTGTTTCCAGTCTATCATGATGG + Intergenic
1052822473 9:33148540-33148562 CTTTTTCCCTTCTGTAATGAGGG - Intronic
1053123425 9:35561941-35561963 CTCTCTCCCTTCCAAAAGGATGG + Exonic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1054953723 9:70884103-70884125 CTATTTGCCATCCATAATGAAGG + Intronic
1055758004 9:79574731-79574753 CCCTTCCCTTTCCATAATGATGG + Intronic
1056375197 9:86002005-86002027 GTCTTTCCTTTCTATATTTAGGG + Intronic
1056862494 9:90199037-90199059 CTCTTTTCCTTCCCTAATCAGGG + Intergenic
1057692779 9:97300997-97301019 ATCTATCCCTTCTAAAGTGAAGG - Intergenic
1058478789 9:105369747-105369769 TTCTTTCCTTTCTCTAGTGAAGG - Intronic
1058985219 9:110203610-110203632 CTCTTTCTCTTGTACAGTGAAGG - Intronic
1059335864 9:113567995-113568017 CTCTTTGCCTTCTATTAGGTTGG + Intronic
1059638511 9:116193300-116193322 CTCTTCCCCTGCTCTAATCAGGG + Intronic
1186664034 X:11700351-11700373 CTTTCTCCCTTCTACAATGAAGG + Intergenic
1186992014 X:15080202-15080224 CCCTTTCCGTTCTATAATTATGG - Intergenic
1187947791 X:24443226-24443248 CTCTTTCCCTCCTTTAAGGCAGG - Intergenic
1188209591 X:27406222-27406244 CTCTTTTTTTTCTATTATGAGGG - Intergenic
1188422123 X:30003107-30003129 CTCTTTACCTGCTATAATATGGG + Intergenic
1188520723 X:31034645-31034667 CTTTTTCCCTCCTGTAAGGATGG + Intergenic
1191670608 X:63745175-63745197 GGCTTTCCTTTCTCTAATGAAGG + Intronic
1191935649 X:66424343-66424365 CTCTTCCCCTTTTAAAGTGAGGG - Intergenic
1192684979 X:73294365-73294387 CACTTTCCTTTCTATATTTAGGG - Intergenic
1193353795 X:80492761-80492783 TTCTGTCTCTTCTATAAAGAGGG - Intergenic
1194799276 X:98251662-98251684 CTCTTTCCCATCTTGCATGATGG + Intergenic
1195214460 X:102685049-102685071 CTGTTTCCCTTCTATATACAGGG + Intergenic
1196421095 X:115522114-115522136 CTCTTTCCTCTCTATAATACAGG + Intergenic
1198818712 X:140622107-140622129 CTCTTCCCCTTCCACCATGATGG - Intergenic
1199501011 X:148505450-148505472 CTCATTCATGTCTATAATGATGG - Intronic