ID: 1088782800

View in Genome Browser
Species Human (GRCh38)
Location 11:113152309-113152331
Sequence AGAAATGCACAGATGCAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088782800_1088782803 -7 Left 1088782800 11:113152309-113152331 CCATACTGCATCTGTGCATTTCT 0: 1
1: 0
2: 1
3: 15
4: 275
Right 1088782803 11:113152325-113152347 CATTTCTGCTTTGGGCATTATGG 0: 1
1: 0
2: 2
3: 31
4: 447
1088782800_1088782804 16 Left 1088782800 11:113152309-113152331 CCATACTGCATCTGTGCATTTCT 0: 1
1: 0
2: 1
3: 15
4: 275
Right 1088782804 11:113152348-113152370 TTTCCATTTCTTTTAACAAGTGG 0: 1
1: 0
2: 5
3: 33
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088782800 Original CRISPR AGAAATGCACAGATGCAGTA TGG (reversed) Intronic
907047045 1:51305754-51305776 AGAAATGCACCGATGGACTCTGG + Intronic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
907876657 1:58495513-58495535 AGAAAACCACAGATCAAGTAAGG - Intronic
908558764 1:65284298-65284320 AGAAAGGCAGAGATGGAGAAAGG - Intronic
908909632 1:69058312-69058334 AGAAATCCACAGCAGCAGCAAGG - Intergenic
909614711 1:77593426-77593448 ACAAATGAACAGATACAGTACGG + Intronic
911176317 1:94821001-94821023 GGAAATGCACAGATACGGCATGG + Exonic
911591599 1:99754167-99754189 AGAAATGGACAGATCCAGGCTGG + Intronic
911656665 1:100451526-100451548 ATAAATGCAAATATGCTGTAAGG - Intronic
913257512 1:116967121-116967143 AGAATTGGACAGATGCATCACGG + Exonic
916105708 1:161429758-161429780 TGATATGCACAGAAGCTGTAGGG + Intergenic
916257140 1:162800611-162800633 AGACATACAAAGAAGCAGTAAGG - Intronic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
917501006 1:175584946-175584968 ACAATTGCACAGAAGCAGTCTGG + Intronic
918393575 1:184091654-184091676 AGAAATGGAAAGAGACAGTAGGG - Intergenic
918635734 1:186772083-186772105 AGAAATGAAGATATGCAGTTAGG - Intergenic
921319870 1:213928221-213928243 AGAAATGCAGAGCTTCACTAGGG - Intergenic
921769508 1:219019553-219019575 AAAAATGAACTGATCCAGTATGG + Intergenic
922543306 1:226435209-226435231 ACAAAAGCACAGATCCAGTCAGG - Intergenic
922919591 1:229291000-229291022 AGAACACCACAGATGAAGTAAGG + Intronic
924310615 1:242738963-242738985 TGGAATGCACAGATGTAGTCTGG - Intergenic
1063650506 10:7932044-7932066 AGAAATGCAGAGATCCCCTATGG + Intronic
1064190824 10:13204147-13204169 ACAAATGCTCAGCTGCAGTAAGG - Intronic
1064455502 10:15484020-15484042 AGAAATGCACTTATTCAGTTAGG + Intergenic
1064517005 10:16161272-16161294 ATAAATGCACAGAGGCTTTAAGG + Intergenic
1064794735 10:18998647-18998669 AGAAATGCACAGAGGAAATTTGG + Intergenic
1066674434 10:37873632-37873654 AAAAATGGATAAATGCAGTATGG - Intergenic
1067237584 10:44464266-44464288 TCAAATTCACAGATGCAGGAAGG - Intergenic
1067302907 10:45030822-45030844 GGAAATGCAGAAATGCAGGAGGG - Intergenic
1068638658 10:59376601-59376623 AGAAATGCACATATGGAGCCTGG + Intergenic
1068665268 10:59668259-59668281 AGGAATGCACAGATGGTGTGAGG - Intronic
1068981058 10:63062579-63062601 AGAAATACACAGATGCAAGAAGG + Intergenic
1069142968 10:64851341-64851363 ATAATGGCACAAATGCAGTAAGG - Intergenic
1069429236 10:68318856-68318878 AGAAGTTCACAGCTGCAGTGAGG + Intronic
1070342446 10:75510380-75510402 AGAAAAGCATAGATGCTGTTGGG + Intronic
1070623978 10:78035859-78035881 TAAAATGCACAGGTGGAGTACGG + Intronic
1072849185 10:98868989-98869011 AGACATGCACACATGCAATTGGG - Intronic
1073366462 10:102946281-102946303 GGAAAGGCACAGAGGCAGAAAGG + Intronic
1074607985 10:114993380-114993402 AGAAAAGGATAGATGAAGTATGG + Intergenic
1074659001 10:115629309-115629331 ATAAATGCTCAGATTGAGTACGG + Intronic
1074936043 10:118182441-118182463 AGAAAGGCTCAGGTCCAGTATGG - Intergenic
1075081300 10:119385684-119385706 ACAAATGGAAAGATGGAGTAAGG + Intronic
1076075657 10:127531915-127531937 AGAAACGCATGGATGCAGCAAGG - Intergenic
1076998305 11:310194-310216 AGAGATGCACAGAGGCTGGAAGG - Intronic
1077000437 11:319564-319586 AGAGATGCACAGAGGCCGGAAGG + Intergenic
1079861601 11:25679206-25679228 AGAAATGCAAAGAAACAGTTGGG - Intergenic
1081198819 11:40192886-40192908 AGAAATGTAGAGAGGCAGTCTGG - Intronic
1081240269 11:40697148-40697170 AAAAATGTATATATGCAGTATGG - Intronic
1082706681 11:56501052-56501074 AGAGAAGCACAGATCCAGGAAGG + Intergenic
1084112108 11:67021101-67021123 TCAAATGCACAGATGCATTGTGG - Intronic
1085054246 11:73394738-73394760 AGATGGGCACAGATGCAGCAGGG + Intronic
1085265541 11:75235961-75235983 AGCAAGGTACAGATGTAGTAAGG + Intergenic
1086161077 11:83722795-83722817 AGAAATGCAAAGAAGCATCAGGG + Intronic
1086501064 11:87454209-87454231 AGAAATGGCCACAAGCAGTATGG - Intergenic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1089905890 11:122038152-122038174 AGAAAACCACAGAAGCAGAAAGG - Intergenic
1090115102 11:123962357-123962379 AAAAATGCAATGATGGAGTAAGG + Intergenic
1090357789 11:126151510-126151532 AACCAGGCACAGATGCAGTAGGG + Intergenic
1090538704 11:127676411-127676433 GGAAATGCACTAATACAGTATGG - Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1092709658 12:11322406-11322428 AGAAATGCCCAAATGGATTAGGG - Intergenic
1092713414 12:11362897-11362919 AGAAATGCCCAAATGGATTAGGG - Intronic
1092717126 12:11402104-11402126 AGAAATGCCCAAATGGATTAGGG - Intronic
1099584542 12:84501315-84501337 AGAAATGCACATATTTACTATGG + Intergenic
1099781076 12:87196254-87196276 AGAAAAGCACAGATTCTGAACGG + Intergenic
1101634659 12:106528593-106528615 AGAAATGCAAAGATGGAGGTGGG + Intronic
1101899149 12:108778348-108778370 AGCATTGCACACATGCATTAGGG + Intergenic
1104128599 12:125871414-125871436 AGAAGTGCACAGAGGCAGCAAGG + Intergenic
1104682933 12:130763693-130763715 AGAGATGCACAGACGAGGTACGG - Intergenic
1108102918 13:46976721-46976743 AGGAATGCACATATGCTGAAAGG + Intergenic
1108211497 13:48144059-48144081 AGAAAAGCACAGAGGAAATATGG + Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1110025064 13:70526930-70526952 AGAGAGGCACAGAGGCAGTGAGG + Intergenic
1110425083 13:75357863-75357885 AGAAATAAACAGAAGCAGGAGGG - Intronic
1110593185 13:77287871-77287893 AAAAATGTACAAAAGCAGTAGGG - Intronic
1110627501 13:77668146-77668168 AGACATGCAAAAATTCAGTAGGG + Intergenic
1110844585 13:80179795-80179817 AAAAAAGCACAGAAGCAGGAAGG + Intergenic
1113894256 13:113753614-113753636 AGACATGCACACACACAGTAGGG + Intergenic
1114154581 14:20086297-20086319 AGAAAGGCACAGAGGCATAAAGG - Intergenic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1116407945 14:44588357-44588379 AGACTTGCACAGATGAATTATGG + Intergenic
1117121089 14:52568727-52568749 AGAAATCTACAGAGGCAGTCTGG - Intronic
1118924719 14:70181645-70181667 ACAAATGCACAAAAGCAGAAAGG + Intronic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1119599537 14:75966023-75966045 AAAAGTACACAGATACAGTAAGG + Intronic
1122005557 14:98700590-98700612 TGAAATGCAGAGATGGAGGAAGG + Intergenic
1126357745 15:47813906-47813928 AGAGATGCGCATATGCAGGAAGG + Intergenic
1126495282 15:49283277-49283299 AGCAAAGCACAGATGCTATATGG - Intronic
1127452565 15:59131245-59131267 GGAAATCTACAGAGGCAGTATGG + Intergenic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1130310692 15:82751234-82751256 AGCAATGCAAAGAAACAGTATGG - Intergenic
1130368518 15:83262994-83263016 AGAAATGCACACATGCACAGTGG - Exonic
1133781627 16:8943430-8943452 CGAGCTGCACAGATGCAGTTAGG + Intronic
1134630790 16:15754505-15754527 AAAAATCCACTGATGAAGTAGGG + Intronic
1136385161 16:29920474-29920496 AGACATACCCATATGCAGTAGGG + Intronic
1137469833 16:48744308-48744330 AGATATAAACAGATGCTGTAAGG + Intergenic
1138708387 16:58941088-58941110 AAAAATGCAGAGATTCTGTAAGG - Intergenic
1139326502 16:66156467-66156489 GGAAATGCACAGCTGCAGTCTGG + Intergenic
1139552956 16:67685959-67685981 AGAAAAGCACAAATGAAATAGGG + Intronic
1140015577 16:71179512-71179534 AGAAGTTCAGAGATGCAGGAAGG + Intronic
1140187245 16:72786270-72786292 GGAAATGAACTGAAGCAGTATGG - Exonic
1143071500 17:4298813-4298835 AGAAATGTAGAAATGAAGTAAGG + Intronic
1143859338 17:9876674-9876696 AGAAAATCACAGAAGCAGGAAGG - Intronic
1148320011 17:46742825-46742847 ATAAATGCAGAGAAGCACTATGG + Intronic
1152314060 17:79569854-79569876 AGGAATGGACAGATGGATTATGG + Intergenic
1152314090 17:79570076-79570098 AGGAATGGACAGATGGATTATGG + Intergenic
1152314119 17:79570294-79570316 AGGAATGGACAGATGGATTATGG + Intergenic
1156030869 18:32710771-32710793 AGAAATGGACAGATGGAGAGGGG + Intronic
1156235118 18:35195765-35195787 AGAAATCCACAGATATAGGAGGG + Intergenic
1156264972 18:35479844-35479866 AGAAAGCCCCAGTTGCAGTATGG + Intronic
1156277917 18:35602377-35602399 ATAAATACACAGATACAGGAAGG - Intronic
1156468659 18:37363807-37363829 AGAAAGGCACAGATGTGGGAGGG - Intronic
1156964133 18:43069733-43069755 ATAAGGTCACAGATGCAGTAGGG - Intronic
1157576775 18:48748948-48748970 AGAGATGCAGAGATGCAGCCTGG - Intronic
1158197329 18:54903317-54903339 AGAAATGCAGACATACAGTCAGG - Exonic
1162245511 19:9396659-9396681 ACAAATGGACAGATCCAGCAGGG + Intergenic
1167980860 19:53273599-53273621 AGACATCCACAGAAGCAGGAAGG - Intergenic
927398686 2:22685767-22685789 TCAAATGCACAGCTGCAGTCAGG + Intergenic
927974570 2:27328301-27328323 ATATATGCTCAGATGCAGTACGG + Intronic
929001078 2:37347396-37347418 AGAAAAGCACAGAAGAAGAAAGG - Intronic
930034283 2:47075869-47075891 AGCAATGCCCAGAGGCAGCAGGG - Exonic
930401327 2:50893171-50893193 ACAAATGCTCAGATGCACTTAGG - Intronic
931547605 2:63406925-63406947 AGAAAACCACAGAAGCAGAAAGG - Intronic
931664389 2:64599866-64599888 AGCAAAGCACAGATTCAGGAAGG - Intergenic
931998445 2:67861454-67861476 AGAAATGTACAGACCCACTATGG - Intergenic
932425877 2:71634856-71634878 TGAAATGAGAAGATGCAGTATGG - Intronic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
932584092 2:73012575-73012597 AGATATGCAAAGATTCAGAAAGG + Intronic
934650119 2:96085829-96085851 AGAAAGGCAGAGAGGCAGGAGGG + Intergenic
936002525 2:108848245-108848267 AGAAAAGCAAAAATGCAATAAGG + Intronic
936772400 2:115930054-115930076 AGAAATGAACAGATCCAGCAAGG - Intergenic
937059011 2:118967664-118967686 AGAAATGCCCAGATGAACAATGG - Intronic
938206251 2:129426721-129426743 AGAACTGAACAGATGGAGGAAGG - Intergenic
940034115 2:149295366-149295388 AGAAAATCACAGAAGCAGGAAGG - Intergenic
940124873 2:150311723-150311745 AGGAATGCAGAGAAGCAGTCTGG - Intergenic
940515814 2:154682714-154682736 AGAAAACCACAGAAGCAGGAAGG - Intergenic
942125647 2:172822579-172822601 AGGAATGCCCAGATGCTGTATGG + Intronic
942361202 2:175173504-175173526 AGAAGTGCAGAGCAGCAGTAGGG - Intergenic
942480931 2:176387409-176387431 AGAGATGAAGAGATGCAGTCTGG - Intergenic
942859511 2:180592164-180592186 GGAAAGGCACAGATTCAGTCAGG + Intergenic
942958800 2:181804978-181805000 AGAAATGCAGAGTTTCAGCAAGG - Intergenic
943040509 2:182798956-182798978 AAAAATGCACATATTCAGTATGG + Intergenic
943824577 2:192372834-192372856 AGAAAAGAACAGAAGAAGTAGGG - Intergenic
944422248 2:199544002-199544024 AGAAAACCACAGAAGCAGGAAGG + Intergenic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
948217206 2:236240583-236240605 AGAAAGCCCCAGATGCAGCATGG + Intronic
1170771132 20:19333325-19333347 TGTAATGAACAGATGCATTAGGG - Intronic
1171088954 20:22266359-22266381 AGGAATACATAGATGCAGTCCGG - Intergenic
1176669779 21:9722441-9722463 AGAAAACCACAGACGCAGGAAGG + Intergenic
1179115598 21:38489055-38489077 AGAGACGCACTGATGCAGGAAGG - Intronic
1182033577 22:27180065-27180087 AGAAGTGCACACCTGCAGAAAGG + Intergenic
949132859 3:526563-526585 AGTTATGCACAGATTCAGTTAGG + Intergenic
950214011 3:11145089-11145111 AGTAATCCACAGATGGGGTATGG - Intronic
951659584 3:25047763-25047785 AGAAATGCAGATAGACAGTATGG - Intergenic
952338268 3:32423653-32423675 AGAACTGCAGTGATGTAGTATGG + Intronic
952672918 3:35993114-35993136 AGAACTGCATGGCTGCAGTAGGG - Intergenic
952685616 3:36144627-36144649 AGGAATTCACAGTTGGAGTATGG - Intergenic
954617278 3:51975554-51975576 AGAAATGCACACACGCAGACAGG - Intronic
954829649 3:53409243-53409265 AGAAAGGCACAGATACACTGTGG - Intergenic
955558445 3:60163170-60163192 AGAACTGCACAGGTCAAGTAAGG + Intronic
959154089 3:102645176-102645198 AGATATGCAGACATGTAGTATGG + Intergenic
959504195 3:107139947-107139969 AGAAATGGACAGTGGCAGTGGGG - Intergenic
959570119 3:107874177-107874199 AGACAGGCACAGACCCAGTAGGG - Intergenic
963374545 3:144447477-144447499 ACAAATTCACAGATCCTGTATGG - Intergenic
963694368 3:148546461-148546483 AGAAATGAAAAGAAACAGTAAGG - Intergenic
964403897 3:156328750-156328772 AGCATTGCACAGAAGCATTAAGG + Intronic
964761622 3:160139919-160139941 AGCTCTGCACAGATGCAGAAAGG - Intergenic
965663374 3:171065495-171065517 ATGAATTCACAAATGCAGTATGG + Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
967941977 3:194773136-194773158 AGAAATGCCCAGATTCAGAATGG - Intergenic
970104620 4:12567353-12567375 AGAAATGGTAAGATGCAGTTAGG + Intergenic
971223835 4:24733295-24733317 AGAAATGGACAGGTGCAGCCGGG + Intergenic
972285650 4:37645276-37645298 TGAAAGGCACAGAGGCAGTGAGG + Intronic
972482485 4:39510721-39510743 AGAAAAGCACAGTTCCAGTGCGG - Exonic
972824479 4:42741054-42741076 AGCAATTTACAGATTCAGTATGG + Intergenic
973044852 4:45523557-45523579 AGAAATACACAAGTGAAGTATGG + Intergenic
973053542 4:45626190-45626212 AGAAATGATGACATGCAGTAGGG - Intergenic
973140581 4:46763509-46763531 AGAAATGGTCAGAAGCAGAATGG - Intronic
973727961 4:53794577-53794599 AGAAATGAATAGATGAAGTGCGG - Intronic
973779445 4:54274466-54274488 AGACATGCACAGGGGCAGCAAGG - Intronic
975233409 4:71961556-71961578 AGAAATACAAAGCTGCAGAATGG - Intergenic
976486522 4:85611902-85611924 AGAAAAGCACAGGTCAAGTAGGG - Intronic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
978977870 4:114901210-114901232 AGAAATGGACAGATTCATCAGGG - Intronic
980488319 4:133490485-133490507 ATAACTACACAGATACAGTAGGG - Intergenic
981404627 4:144353796-144353818 AGAAATACACAGATGTAGACGGG + Intergenic
981628470 4:146789027-146789049 ATAAATTCACAGATGGAATATGG - Intronic
983265989 4:165508549-165508571 AGAAATGCAAAGATGCCGCTGGG + Intergenic
985405003 4:189629079-189629101 AGAAAACCACAGAAGCAGGAAGG - Intergenic
988613670 5:32752277-32752299 AGTTTTGCACAGAAGCAGTATGG + Intronic
988717133 5:33839444-33839466 AGTAATGCACAGATGTGGAAAGG - Intronic
989187056 5:38635938-38635960 AGAAATGCCCACATGGGGTATGG + Intergenic
990836691 5:60029472-60029494 AGAAGTGCACTGATTCAGTCTGG - Intronic
993265504 5:85721756-85721778 AGAAATCCAGAGAGGCAGTCTGG - Intergenic
996208993 5:120781598-120781620 AGAAAACCACAGAAGCAGGAAGG - Intergenic
997192859 5:131955342-131955364 AAAGAAGCACAGATTCAGTAAGG + Intronic
999565017 5:152849572-152849594 AGAAATGGACAGATCTAGCAGGG - Intergenic
999577833 5:152999670-152999692 AGAAATGCTCAGAGGAAGTCAGG + Intergenic
1000313270 5:160064876-160064898 AGGAATGAACAGAAGCAGGAAGG - Intronic
1000960351 5:167593801-167593823 AGAAATGCAAAGATCCACAATGG - Intronic
1001622306 5:173097698-173097720 AGAAATGCAAAGAATCATTAAGG - Intronic
1002809282 6:611228-611250 AGATCTGCACACATGCAGCATGG - Intronic
1003419190 6:5940457-5940479 AGAAAAGCACAGAACCAGTCAGG - Intergenic
1003748411 6:9027896-9027918 ACCAATGCACAGATCCAGGAAGG + Intergenic
1004628065 6:17394676-17394698 TGAAATCTACAGAAGCAGTAAGG - Intronic
1005408662 6:25519323-25519345 AGAAATGGACAGATGCATTTTGG + Intronic
1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG + Intronic
1007017583 6:38484159-38484181 AGACATGCACAGAAGCATAAAGG + Intronic
1010662952 6:78592586-78592608 AGAAATGGACTCATGCAATAAGG + Intergenic
1011346992 6:86381147-86381169 AGCAAGACACAGATGCAGTGGGG - Intergenic
1012563738 6:100619596-100619618 AAAAATGTACAGATGATGTATGG + Intronic
1015329416 6:131959659-131959681 AGAAAAGCAAAGGTGCAGTGAGG + Intergenic
1016615037 6:146037950-146037972 AGAGTTGCTCAGATGCAGAAGGG - Intronic
1016959032 6:149653963-149653985 AGAATTGAACAGATGAAGTGTGG + Intergenic
1017596423 6:156033974-156033996 AAAAATCCACAGATCCAGGAAGG - Intergenic
1020553262 7:9635201-9635223 ACAACTGCACAGATGAAGTTTGG - Intergenic
1020757972 7:12228282-12228304 AGATATGAAAAGATGCAATATGG - Intronic
1021026917 7:15679831-15679853 AAAAATGTATAGATACAGTACGG + Intronic
1021060881 7:16110064-16110086 AAAAATACACATATACAGTAAGG + Intronic
1021338798 7:19437804-19437826 ACAAATGTACAAATGCAGGATGG - Intergenic
1021783004 7:24124461-24124483 AGAACTGCACAGACTCACTAAGG - Intergenic
1021845628 7:24759707-24759729 AGAAGTGCAGAAGTGCAGTAGGG + Intergenic
1021931956 7:25589893-25589915 AGAAAAGTACAGATGCAGAGAGG - Intergenic
1022510246 7:30930732-30930754 AGACGTGCACAGATGCAGCGTGG - Intergenic
1022853194 7:34287251-34287273 AGAAATACACATAGGCAATAAGG + Intergenic
1023447221 7:40244338-40244360 ACAAATGCAGAGAAGCAGGAAGG + Intronic
1023991148 7:45129635-45129657 AGAAAGGCACAGACGGAGTGGGG - Intergenic
1025068063 7:55874757-55874779 AGGAATGCACAGATGCCAGAGGG + Intergenic
1026759264 7:73114222-73114244 AGAAATGAACAAATGCACTGCGG - Intergenic
1027088144 7:75279251-75279273 AGAAATGAACAAATGCACTGCGG + Intergenic
1027263502 7:76481139-76481161 AGAAACGCACACATGCAGAGGGG - Intronic
1029324730 7:99796420-99796442 AGAAATCCAGAGAGGCAGTCTGG + Intergenic
1029394252 7:100296409-100296431 AGAAATGAACAAATGCACTGTGG + Intergenic
1030909701 7:115231592-115231614 AGAAATGCACAGACATTGTAGGG + Intergenic
1031523103 7:122790324-122790346 AGACATTCACAGCTGCAGTGAGG + Intronic
1031825279 7:126557386-126557408 AAAAATGTACAGAGACAGTAAGG - Intronic
1032660090 7:133973484-133973506 AGTAATTCACATATTCAGTAGGG + Intronic
1033961800 7:146922576-146922598 AGAATTGAAGAGAGGCAGTATGG + Intronic
1037609319 8:20463170-20463192 AGAAAAGCACAGAGCCAGTTAGG + Intergenic
1039087876 8:33797869-33797891 AGAAATGCAGAGTTTCAGAATGG - Intergenic
1039617564 8:38968606-38968628 AGACATGCACAGCTGGATTAAGG + Exonic
1042154192 8:65824131-65824153 AGAAGTGAGCAGATGCAGTTGGG - Intronic
1042374823 8:68038414-68038436 AGAAATGCACTGATGGATGATGG - Intronic
1042935343 8:74052675-74052697 AGAAATGCACCTAGGAAGTAAGG + Intergenic
1043238805 8:77904259-77904281 AGAAATCCAGAGATGTAATAAGG - Intergenic
1043412825 8:80016877-80016899 AGAAAAGGACAGATCCAGCAGGG + Intronic
1043548349 8:81340130-81340152 AATACTGCACAGATGCAATAAGG + Intergenic
1044516020 8:93139743-93139765 AGGAATGCACAGATGCCCTTGGG + Intronic
1046669353 8:117041051-117041073 AGGAATGCACAGATGCATGCTGG + Intronic
1047352695 8:124090959-124090981 AGAAATGCATAGAGACAGAAAGG + Intronic
1047489131 8:125359911-125359933 AGCAATGCAGAGATGGATTAAGG + Intronic
1047717069 8:127605348-127605370 AGAAATGCCCATATGGAGCATGG - Intergenic
1047724579 8:127672805-127672827 AGAAAGAAACAGATACAGTAGGG + Intergenic
1047948993 8:129912554-129912576 AAAGATGCACAGATGCACTCTGG + Intronic
1048419116 8:134259700-134259722 AGCAATACACAGTTGCAGTTGGG + Intergenic
1050432911 9:5580115-5580137 AGAAGTCCACAGATGCATTTGGG - Intergenic
1051016783 9:12486780-12486802 AGAAATGGACAGTTTCAGCAAGG + Intergenic
1051138831 9:13955255-13955277 AGAAAACCACAGAAGCAGGAAGG + Intergenic
1051489653 9:17647081-17647103 AGGAATCCAGAGAGGCAGTATGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055327969 9:75151755-75151777 AGTAATTCAAAGATGAAGTAGGG + Intergenic
1055336063 9:75234819-75234841 AAAAGTTCCCAGATGCAGTAAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057770557 9:97963832-97963854 AGAAATCCAGAGAGGCAGAAGGG - Intergenic
1058259842 9:102814800-102814822 AGAAATGTAGAGAGGCAGTCTGG - Intergenic
1059767741 9:117399928-117399950 AGAAGTGGACAGTGGCAGTATGG + Intronic
1059870142 9:118563640-118563662 AGAAATGCACATTTCCCGTAAGG + Intergenic
1059913543 9:119073941-119073963 AGAAATACACAGATGTAGATAGG + Intergenic
1060154662 9:121310924-121310946 ACAAATGCATAGATGCAGGTGGG + Intronic
1060510072 9:124225200-124225222 AGGGAGGCACAGATGCAGAAAGG + Intergenic
1061058564 9:128238583-128238605 AGAAATGCATACATCCACTAAGG - Intronic
1186635846 X:11403966-11403988 AAAAAGACACAGATGCAGAAAGG + Intronic
1187322213 X:18250121-18250143 AGACATGCAAAGAAACAGTATGG + Intronic
1187614247 X:20975924-20975946 AGAAAACCACAGAAGCAGGAAGG + Intergenic
1188131907 X:26446323-26446345 ATAAATGCAAAGTTTCAGTATGG + Intergenic
1189134286 X:38532906-38532928 AGAAATGAACACATCCAATATGG + Intronic
1189255815 X:39638159-39638181 AGCAATGCACAGAGACAGTCAGG + Intergenic
1189375905 X:40466304-40466326 AGAAATGCAAAGATGCCCTATGG + Intergenic
1190453353 X:50602492-50602514 AGAAATCCAGAGAGGCTGTATGG + Intronic
1193418960 X:81260315-81260337 ACAAATGCTCAGATGGATTAAGG - Intronic
1193646492 X:84075515-84075537 ATAAATTCACAGATACAATAAGG + Intronic
1194698742 X:97088338-97088360 AGAAATGAGCAGATGAAGAATGG - Intronic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1196121478 X:112055862-112055884 ACAACTGCACAGTTGTAGTAAGG + Intronic
1197441237 X:126494062-126494084 AGAAATTCACAGAAGTAATAAGG + Intergenic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1198597958 X:138257626-138257648 AGAGATTCAGAGAGGCAGTAAGG + Intergenic
1198897107 X:141467701-141467723 AAAAATGCACAGGTGTGGTATGG + Intergenic
1199788452 X:151127259-151127281 ATACATGCACAGATCCTGTAGGG - Intergenic