ID: 1088787041

View in Genome Browser
Species Human (GRCh38)
Location 11:113191335-113191357
Sequence GGATATACTAAGTTTAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088787041_1088787047 4 Left 1088787041 11:113191335-113191357 CCCTGTTTAAACTTAGTATATCC 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1088787047 11:113191362-113191384 GCCTGAATCATATAGCTCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088787041 Original CRISPR GGATATACTAAGTTTAAACA GGG (reversed) Intronic
903828311 1:26160584-26160606 GGAAATGCAAAGGTTAAACAAGG + Intronic
908823759 1:68114459-68114481 GCATATAGTAAGTTTTAAAAAGG - Intronic
911856994 1:102891062-102891084 ATATATACTAAATTAAAACATGG + Intronic
918451992 1:184667982-184668004 GCAGATACAAAGTTTAAAAAGGG - Intergenic
918864129 1:189872707-189872729 GGAGATACAAAGTTCAACCACGG + Intergenic
919311163 1:195911537-195911559 GGATATTCTATTTCTAAACAAGG + Intergenic
920036396 1:203068400-203068422 GGAGATACTACGTTTCATCAAGG - Intronic
921641317 1:217558595-217558617 GAATATAGGAAGTCTAAACAGGG - Intronic
1064241723 10:13636072-13636094 GGATAAAGCAAGATTAAACAAGG + Intronic
1064465765 10:15579544-15579566 AGATACACTAAGCTTAAAGAAGG + Intronic
1069284414 10:66694857-66694879 GGAAATACCAAATTTAAAAATGG - Intronic
1074564873 10:114568244-114568266 AGTTTTACTAAGTTTAAAAAGGG + Intronic
1079585496 11:22121961-22121983 GCATATACTATATTTAATCATGG + Intergenic
1081185020 11:40031765-40031787 GAATATAATAAGTTTAAATCTGG + Intergenic
1081227751 11:40545632-40545654 GCACATATTAAGTATAAACAAGG + Intronic
1082183945 11:49156356-49156378 GGAGATACTAATTTTGAATAAGG + Intronic
1085958860 11:81435456-81435478 GGAAATATTAACTTTAAATAAGG + Intergenic
1086577406 11:88355660-88355682 GGATATCCTAATTTTATACAGGG + Intergenic
1087227379 11:95616420-95616442 GGATAAAATAACTTTGAACAGGG + Intergenic
1088036313 11:105320446-105320468 CGATATAAAAAGTTTAAGCAAGG + Intergenic
1088787041 11:113191335-113191357 GGATATACTAAGTTTAAACAGGG - Intronic
1090979566 11:131706281-131706303 GGATATAACAATTTTAAATATGG + Intronic
1091936525 12:4439286-4439308 GGACATACAAAGTTAGAACAGGG - Intronic
1093107894 12:15111597-15111619 GGACATACCAAGTTCTAACATGG + Intronic
1093394656 12:18666428-18666450 GGCTATACTAATTTTTAAAATGG + Intergenic
1095880827 12:47134461-47134483 GAAAATATTAACTTTAAACAGGG + Intronic
1095898378 12:47303393-47303415 GGAAATACTTGGCTTAAACAAGG + Intergenic
1099616979 12:84948704-84948726 GCATACACTAAGTTGAAAAAGGG - Intergenic
1100079416 12:90829520-90829542 TAGTATTCTAAGTTTAAACAAGG - Intergenic
1101183885 12:102252323-102252345 GGAAAAACTAAGTTTGAAAATGG - Intergenic
1103709219 12:122898570-122898592 AAACGTACTAAGTTTAAACACGG + Intergenic
1105486785 13:20840885-20840907 AGATATACTTTCTTTAAACAAGG + Intronic
1105788897 13:23777924-23777946 GGACATACTAAGTTTTAAGAGGG + Intronic
1109157723 13:58931456-58931478 GGATATACCAGGATTAAACCTGG + Intergenic
1109435692 13:62297697-62297719 GAATATACTAAAGTTAATCAAGG - Intergenic
1110107643 13:71697816-71697838 GGCTATATTAATTTTAAAAATGG + Intronic
1113911804 13:113845179-113845201 GGAAATGCTCAGTGTAAACATGG - Intronic
1115209182 14:30947687-30947709 AGACATACTAAGTTTAAACCTGG + Intronic
1117219183 14:53585018-53585040 TGATATTTTGAGTTTAAACATGG + Intergenic
1117809638 14:59532990-59533012 GGAAATGCTAAGTTTTAGCAGGG + Intronic
1118546136 14:66891354-66891376 GGATGTAATAATTTTCAACAAGG + Intronic
1118732790 14:68680851-68680873 TAATATACTAAGTTTAAACTTGG + Intronic
1122736315 14:103845008-103845030 GGATATGCTAAGTTAATAAAAGG + Intronic
1127298942 15:57634009-57634031 GGATAAACTAAGTTCACACCTGG - Intronic
1128094822 15:64946127-64946149 AGTTTAACTAAGTTTAAACATGG - Intronic
1128610198 15:69067023-69067045 GTATATGCTAAGTTTATAAATGG + Intergenic
1130014141 15:80174388-80174410 TAATATATTAAGTTTAAACTGGG - Intronic
1131222894 15:90599820-90599842 AGAGATACTGAGTTTAAAGATGG + Intronic
1132067102 15:98740767-98740789 GGATCCACACAGTTTAAACAAGG + Intronic
1134895559 16:17883453-17883475 GGATATATTAAGTAAAAATAAGG + Intergenic
1137055049 16:35741395-35741417 TGATAAACTAAGTGTAATCAGGG + Intergenic
1139216208 16:65126033-65126055 GGAACTTCTAAGTCTAAACAAGG - Intronic
1141279431 16:82617776-82617798 GGAGATACTGAGTTGAACCAGGG - Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1153857167 18:9161255-9161277 AGATATACTTAGTTTTACCATGG - Intronic
1155499918 18:26477458-26477480 GTATATACTCAGTTAATACAAGG + Intronic
1155766871 18:29646863-29646885 TTATATACTAAATTTCAACAAGG + Intergenic
1156287882 18:35716722-35716744 GGATATAATAAGTATAATAATGG + Intergenic
1156758114 18:40553305-40553327 GGATTTCCTAAGTTTAAACAGGG - Intergenic
1158368188 18:56764773-56764795 GTATATACTAAACTTGAACACGG - Intronic
1159072284 18:63639113-63639135 AAAGATACCAAGTTTAAACAAGG - Intronic
1159073727 18:63656759-63656781 AAAGATACCAAGTTTAAACAAGG - Intronic
1159191373 18:65047747-65047769 GGATATATGAAGTATAAACTTGG - Intergenic
1165455973 19:35910853-35910875 GGACATACTAATTTTTAGCATGG - Intergenic
1167306347 19:48712201-48712223 GGCTATAATAAGCTCAAACAGGG + Intergenic
1168360455 19:55735585-55735607 GTATATACTATTTTCAAACATGG + Intronic
925980898 2:9176610-9176632 AGATATACTAAGTTTGATAAAGG + Intergenic
926555002 2:14347280-14347302 GGATAAACTTATTTAAAACACGG + Intergenic
928568384 2:32577518-32577540 GGAAATACACAGTTTAAAGAAGG - Intronic
928806753 2:35166767-35166789 CAATTTACTAAGTTTGAACATGG - Intergenic
929269140 2:39953772-39953794 GCATATACTAGGTTTATAAAAGG + Intergenic
930163678 2:48182981-48183003 GGATATACTGCATTTTAACAGGG - Intergenic
931122545 2:59235869-59235891 AGATATAATTAGTTTAAATAAGG - Intergenic
931522720 2:63117229-63117251 AGATAGATTAAGTTTAAAAAAGG - Intergenic
934983623 2:98868740-98868762 GGAGATCCCAAGTGTAAACACGG + Intronic
937958162 2:127434981-127435003 GGATATAATTAGTTAAGACAAGG + Intergenic
938878330 2:135557288-135557310 GGATATACTTACGTTAAATATGG - Intronic
941770903 2:169344637-169344659 GGATATAATAAAATGAAACAGGG - Intronic
942608681 2:177718513-177718535 GGATATTTTTAGTTTAAATATGG + Intronic
943407058 2:187502402-187502424 GGATAAAATAAGTCTTAACAGGG - Intronic
943515188 2:188876623-188876645 GGATGTCCTCAGTTAAAACATGG - Intergenic
943550392 2:189331724-189331746 ATATATACTAATTTTAAAAATGG + Intergenic
946064259 2:216973258-216973280 TGATATGCTCATTTTAAACAGGG - Intergenic
1169686042 20:8273177-8273199 GGATGAACTAAATTTTAACAAGG + Intronic
1169881127 20:10348552-10348574 GGATATATTATTTTTTAACAAGG - Intergenic
1169938795 20:10914699-10914721 GAAAATACCAAGTTTCAACATGG + Intergenic
1172412776 20:34738464-34738486 GGATATACTTAATTTACACCAGG + Intronic
1172822946 20:37754688-37754710 ATATACACTCAGTTTAAACACGG - Intronic
1173738877 20:45381673-45381695 GGATAAAAAAAGTTTAAAGATGG - Intronic
1178116698 21:29425248-29425270 GAATAACCTAAGTTTAAATATGG + Intronic
1178923867 21:36759248-36759270 GGATGTGCTAAGGTGAAACAGGG + Intronic
1179926429 21:44537559-44537581 GAATAAACTAACTTTAAAAAAGG + Intronic
1182648696 22:31832403-31832425 GGATATACCAAGTGTTGACAAGG - Intronic
1183536868 22:38407270-38407292 GGATATAGAAAATATAAACAGGG - Intergenic
949144556 3:681839-681861 GGATATTCACAGTTGAAACAGGG - Intergenic
954026826 3:47789708-47789730 GGACAAACAAGGTTTAAACATGG - Intergenic
954828651 3:53398973-53398995 GGATATACCGAGTTAAAAAAAGG + Intergenic
956510115 3:69984375-69984397 GGATAGATTACGTTTTAACATGG - Intergenic
957410964 3:79839599-79839621 GCATGCACTTAGTTTAAACAAGG - Intergenic
957554097 3:81743907-81743929 TGATATGTTAAGTGTAAACATGG - Intronic
959437628 3:106336245-106336267 AGAAATACTAAGTCTAAAAATGG - Intergenic
960498676 3:118408331-118408353 TGAAATACTAAGTTGAAAAAAGG - Intergenic
963792993 3:149603228-149603250 TGATTTACTAAGTTCAATCAAGG + Intronic
964031954 3:152148473-152148495 GGATGTATTAAGATCAAACAAGG + Intergenic
964173969 3:153803275-153803297 GGCTATACTAATTCCAAACATGG + Intergenic
967663387 3:192141295-192141317 GGATATTATATGTTTACACATGG + Intronic
970255472 4:14164954-14164976 GGATATACTAGGTTAAAAAAAGG + Intergenic
972110214 4:35548939-35548961 TGATATACTAGTTTTTAACAAGG + Intergenic
974319281 4:60324012-60324034 GGATATACTGTGTTCAAAAATGG + Intergenic
975231621 4:71941295-71941317 GGATATACTAAGTTGTGCCATGG - Intergenic
979690594 4:123554646-123554668 GCATATGCAAAGTGTAAACAGGG - Intergenic
980491012 4:133529049-133529071 GCATATGCTAAATTTAAAAAAGG - Intergenic
981834148 4:149035841-149035863 GGAGATAATAAGTTTGAGCATGG - Intergenic
982607187 4:157529337-157529359 TTGTATACTAAGTATAAACAGGG - Intergenic
983586390 4:169359600-169359622 GGCTATACTAATATTAGACAAGG + Intergenic
983868191 4:172793021-172793043 GGATATAGTAAGTTTTCACATGG - Intronic
983904069 4:173167271-173167293 GGCTATCCTAAGTTTTAAGATGG - Intergenic
983971621 4:173882551-173882573 GGATATACGCAGTTAAATCATGG + Intergenic
987483642 5:18493418-18493440 GGATGTAGTAGGTTTACACATGG + Intergenic
987523201 5:19014270-19014292 TGATAAACTGAGTTTCAACAGGG - Intergenic
987872202 5:23635095-23635117 GTATATACAGAGTTTAAAGAGGG + Intergenic
988677228 5:33444854-33444876 GGAGAGACTAGGTTTACACATGG + Intronic
990119588 5:52434266-52434288 GGAGATAATTAGGTTAAACAAGG + Intergenic
997051735 5:130389453-130389475 CAGTATACTAAGTATAAACAAGG + Intergenic
998919907 5:147056604-147056626 GGAAAAACTAAGTTGATACAAGG + Intronic
1002801279 6:523607-523629 AGTTAGACTAAGTTTAAACAGGG + Intronic
1003329281 6:5116360-5116382 GGAAATACTCAGTTCACACAGGG + Intronic
1005714402 6:28533289-28533311 GGATATATAAAGTCTTAACATGG - Intronic
1006980124 6:38140927-38140949 AAATAAACTAACTTTAAACATGG + Intronic
1007726388 6:43918461-43918483 GGATGTACCAAATTTCAACACGG + Intergenic
1008207145 6:48675029-48675051 GCATATAATAAATTAAAACATGG - Intergenic
1008852497 6:56040267-56040289 TGAAATGCTAATTTTAAACAAGG - Intergenic
1013687766 6:112605192-112605214 GGATATACAAATTGCAAACAGGG + Intergenic
1017452697 6:154568735-154568757 CTATATACTAAGTTCAAACATGG + Intergenic
1018789132 6:167132482-167132504 GGAAGGACTAAGATTAAACAGGG - Intronic
1020526667 7:9270075-9270097 GGGTATCTTAAGTTTTAACAAGG + Intergenic
1020718803 7:11715289-11715311 GGAGATTCCAAGTTTATACATGG + Intronic
1020881853 7:13771811-13771833 GGACATAGAAAGTTTAAAAAAGG - Intergenic
1023179645 7:37469215-37469237 GGACATAATATGTTTGAACATGG - Intergenic
1023325541 7:39051813-39051835 GGATACACTATGTTTGAATAAGG - Intronic
1024915414 7:54493554-54493576 GGAAATACTAAGTTATAAGAAGG + Intergenic
1027981454 7:85229111-85229133 AGATATACTAAGTTGTAAAATGG + Intergenic
1028450819 7:90981076-90981098 GGATACACTGAGTGTAAAAAAGG + Intronic
1033872927 7:145778989-145779011 AGACTTACAAAGTTTAAACAAGG - Intergenic
1033919637 7:146374002-146374024 GGATATATTTCATTTAAACAGGG + Intronic
1033941097 7:146655064-146655086 GAATATACTTAGTATAAACTAGG - Intronic
1035881545 8:3248336-3248358 GGATATTTTAAGAGTAAACATGG - Intronic
1036484812 8:9170145-9170167 TGACATTCTAAATTTAAACAGGG - Intergenic
1037269369 8:17109540-17109562 AGATATACTAAGTGTGAAAAGGG + Intronic
1038847797 8:31245828-31245850 GGAAATACTGAGTTTAAAGTAGG - Intergenic
1042337959 8:67648314-67648336 GTAAATACTAATTTTATACACGG - Intronic
1043264593 8:78248399-78248421 GGATTTACTGAGGTTGAACATGG - Intergenic
1048641176 8:136363664-136363686 GGAAATGGTAAGATTAAACAGGG + Intergenic
1050765476 9:9127865-9127887 AGATATACGAAATTCAAACAGGG - Intronic
1051468398 9:17406683-17406705 GGATAGACTAAATTTATTCATGG + Intronic
1053182257 9:35982843-35982865 GGACATACTAATTTTTAACCTGG - Intergenic
1054839006 9:69715169-69715191 GGATTTAACAAGTTTAAACAAGG + Intronic
1055363680 9:75522229-75522251 GGATATACTATGTTAAAATAAGG - Intergenic
1056246693 9:84702513-84702535 AGCTATACTAACTTTAAAAAGGG - Intronic
1058874856 9:109235322-109235344 GTATATTCTAAGTTTACAAAGGG - Intronic
1059585219 9:115598617-115598639 GGATATACTAAGTAAACAAAAGG + Intergenic
1187190498 X:17030519-17030541 GGATAAACAAAGTCTAAAGAAGG + Intronic
1187782019 X:22837722-22837744 GGATATACTGATTTTAAAGTGGG + Intergenic
1187827368 X:23345463-23345485 GGATATACAAAGGTTCAGCAAGG - Intronic
1189839562 X:45059871-45059893 GAAGACACTAAGTATAAACAGGG - Intronic
1193735939 X:85156438-85156460 AGATAAACTAAGTTTACAGAAGG + Intergenic