ID: 1088789487

View in Genome Browser
Species Human (GRCh38)
Location 11:113211762-113211784
Sequence GTTCAGGGATGCAGGGGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 355}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088789477_1088789487 4 Left 1088789477 11:113211735-113211757 CCCCATAGCATAGTGTCCAACCT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1088789487 11:113211762-113211784 GTTCAGGGATGCAGGGGCCTCGG 0: 1
1: 0
2: 3
3: 39
4: 355
1088789479_1088789487 2 Left 1088789479 11:113211737-113211759 CCATAGCATAGTGTCCAACCTCT 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1088789487 11:113211762-113211784 GTTCAGGGATGCAGGGGCCTCGG 0: 1
1: 0
2: 3
3: 39
4: 355
1088789476_1088789487 30 Left 1088789476 11:113211709-113211731 CCTGAAAGAAGGTGCATCTGGTC 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1088789487 11:113211762-113211784 GTTCAGGGATGCAGGGGCCTCGG 0: 1
1: 0
2: 3
3: 39
4: 355
1088789478_1088789487 3 Left 1088789478 11:113211736-113211758 CCCATAGCATAGTGTCCAACCTC 0: 1
1: 0
2: 2
3: 5
4: 84
Right 1088789487 11:113211762-113211784 GTTCAGGGATGCAGGGGCCTCGG 0: 1
1: 0
2: 3
3: 39
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088789487 Original CRISPR GTTCAGGGATGCAGGGGCCT CGG Intronic
900398853 1:2464653-2464675 CTGCAGGGAAGCCGGGGCCTGGG + Intronic
900465031 1:2821411-2821433 GTTCATGGGTGGATGGGCCTGGG + Intergenic
900530342 1:3149934-3149956 GTTCAAGGAGGCAGGAGCCCCGG + Intronic
900743150 1:4342739-4342761 TTTCAGGGATCCAGAGGTCTGGG + Intergenic
900782431 1:4626765-4626787 GTGCAGGGCTGCAGGGACCGAGG + Intergenic
901317064 1:8316597-8316619 GGACAGGGATGCAGAGGCCTGGG - Intergenic
901738160 1:11325378-11325400 GCCCAGTCATGCAGGGGCCTGGG + Intergenic
902393633 1:16120327-16120349 GTTCTGAGCTGCAGGGACCTTGG - Intergenic
904759506 1:32791999-32792021 GTTCAGGGCTGGAGGAGGCTAGG + Intronic
905171957 1:36114859-36114881 GTTCTGGGCTGGAGGGGGCTTGG + Intronic
907936541 1:59046961-59046983 GTTCTGGGAAGCTGGGGCTTTGG + Intergenic
914425468 1:147571799-147571821 CTTCAGGTATGCAGAGGTCTGGG - Intronic
914677560 1:149916471-149916493 GTTCAGGGTTACAAGGTCCTAGG + Intronic
915535474 1:156532943-156532965 GCTCAGGTATGCAGGGGCAGAGG + Intronic
918323091 1:183383250-183383272 GTGCAGGGCAGCAGAGGCCTGGG + Intronic
919404816 1:197166036-197166058 GTTGGGGGATGGGGGGGCCTGGG + Intronic
920631752 1:207659378-207659400 GATGAGGGATGCAGGGCCATGGG - Intronic
921135528 1:212256033-212256055 GTTCTGTGAGGCAGGGACCTGGG - Intergenic
921621461 1:217330331-217330353 GTGCAGGGCAGCAGGGCCCTGGG + Intergenic
922748118 1:228058630-228058652 GTGCAGGGATGCAGGGGGATAGG - Intronic
923361866 1:233219448-233219470 GGTCAGGGAACAAGGGGCCTGGG + Intronic
1063573540 10:7239892-7239914 GTGCAGGGGTGCAGGGGTGTCGG - Intronic
1064119414 10:12605938-12605960 GTTCTGGGGTGGAGGGGGCTGGG + Intronic
1064584156 10:16822939-16822961 ATGCAGGGAAGCAGGGCCCTGGG - Intergenic
1064701328 10:18024267-18024289 GTTCAGGAATCCAAGGCCCTTGG + Intronic
1065367955 10:24952977-24952999 GATCTGGGAATCAGGGGCCTGGG - Intergenic
1065998845 10:31085328-31085350 GTTCAGGGGTGCAGTGGGGTGGG + Intergenic
1067041176 10:42954035-42954057 TTTCAGGTGTGCAGGGGTCTTGG + Intergenic
1067069489 10:43121414-43121436 GATGAGGGATGTAGGGGGCTGGG + Intronic
1067322001 10:45230010-45230032 GTGCAGGGAAGCAGGGCCCTGGG - Intergenic
1067453539 10:46397369-46397391 GGACAGAGATGCAGTGGCCTAGG - Intergenic
1067583691 10:47462377-47462399 GGACAGAGATGCAGTGGCCTAGG + Intronic
1067633695 10:47987725-47987747 GGACAGAGATGCAGTGGCCTAGG + Intergenic
1067796147 10:49323595-49323617 GTGCAGGGATCCAGGAGCCCAGG + Exonic
1068580207 10:58730833-58730855 GTGCGGGGTTGCAGGGCCCTTGG + Intronic
1069210065 10:65745554-65745576 GTTCAAGGATGCAGTGAGCTGGG + Intergenic
1069894662 10:71672925-71672947 GTGCAGGAAGGGAGGGGCCTGGG - Intronic
1071338340 10:84620561-84620583 GTGCAGGGTAGCAGGGCCCTGGG - Intergenic
1071571428 10:86699553-86699575 GTACAGAGCTGCAGGGGGCTGGG - Intronic
1073979844 10:109142357-109142379 GTTCAGGGCAGCTGGGCCCTGGG - Intergenic
1074566701 10:114585796-114585818 TCTCAAGGATGCAGAGGCCTGGG - Intronic
1075543316 10:123334434-123334456 GTTCAGTGATGCAGTGCGCTGGG + Intergenic
1075721414 10:124589777-124589799 GTTCAGGCCTGCAGGGTCCCTGG + Intronic
1075903793 10:126063783-126063805 GTTCTGGGGTGACGGGGCCTTGG + Intronic
1076484451 10:130807203-130807225 GGTCTGGGATGCAGGGACGTTGG - Intergenic
1078042855 11:7884369-7884391 GTTCAGGGATGCAGGGAAAGGGG + Intergenic
1080136240 11:28857853-28857875 GTGCAGGGCAGCAGGGCCCTGGG + Intergenic
1081639017 11:44740192-44740214 CTTGTGGGGTGCAGGGGCCTGGG + Intronic
1083203815 11:61135395-61135417 GTTCAGGGATGTAGGGCCCAGGG + Intronic
1083272191 11:61578186-61578208 GATCAGGGAACCAAGGGCCTGGG + Intronic
1083855487 11:65391024-65391046 CATCAGGGGTGCAGGGGCCGGGG - Intronic
1083969031 11:66061280-66061302 GTTTAGGGATGGAGGGGCCAAGG + Intronic
1083994158 11:66263983-66264005 GGTCTGGGAGGCAGGGGCCCGGG + Intronic
1084149813 11:67282835-67282857 GTGCAGGGCCGCAGGGGGCTGGG + Intronic
1085214454 11:74816151-74816173 TTTCAGGAATGCAGGGTACTCGG + Intronic
1088681862 11:112250261-112250283 TGTCAGGGAAGCAGGAGCCTAGG + Intronic
1088789487 11:113211762-113211784 GTTCAGGGATGCAGGGGCCTCGG + Intronic
1089625694 11:119749332-119749354 CTCCAAGGATGCAGGGGTCTAGG - Intergenic
1089727438 11:120494876-120494898 ATTCAGAGTTGAAGGGGCCTTGG - Intergenic
1090640633 11:128726344-128726366 ATCCAGGGGTGCAGGGGGCTGGG + Intronic
1090710120 11:129376198-129376220 GTACAGGAATGCAGGGGCTTGGG - Exonic
1090711043 11:129385607-129385629 GTTTAGAGAGGCAGGGGCATGGG + Intronic
1091165444 11:133471876-133471898 GGTCAGGGTTGCAGGGACCAGGG - Intronic
1091289185 11:134427748-134427770 GGTCAGGTCTGCAGGGGCATTGG + Intergenic
1091318788 11:134635132-134635154 GTTCAGGAGGGCAGGGGGCTTGG - Intergenic
1091670231 12:2447280-2447302 GTTTAGGGAGGCAGCTGCCTTGG - Intronic
1093105950 12:15087299-15087321 GTTTTGGGCTGCGGGGGCCTAGG + Intergenic
1094002178 12:25707260-25707282 GTGCAGGGCAGCAGGGACCTGGG - Intergenic
1094500361 12:31015872-31015894 GTTCTGGAAGGCAGGGGCCCCGG - Intergenic
1096258185 12:50075239-50075261 CTGCAGGCATACAGGGGCCTGGG + Intronic
1096513232 12:52143421-52143443 GCTCAGTGATGGAGGGGCCAGGG - Intergenic
1096527151 12:52217238-52217260 GCTCAGGGAAGGAGGAGCCTAGG - Intergenic
1096646645 12:53041713-53041735 GTTCAGCCATGCAGGGGTGTTGG + Exonic
1096973585 12:55685666-55685688 TTCCAGAGATGCAGGGGACTAGG - Intronic
1097136840 12:56864263-56864285 GTGCAGGGCAGCAGGGCCCTTGG - Intergenic
1097179725 12:57164858-57164880 GTTAAGGAATGGAGGGGCCAAGG + Intronic
1098434052 12:70450443-70450465 GTGCAGGGCAGCAGGGCCCTGGG - Intergenic
1098559130 12:71852273-71852295 GTGCAGGGCAGCAGGGCCCTAGG + Intronic
1098975299 12:76896028-76896050 GGTCTGGGAGGCAGGGGACTTGG + Intergenic
1100796244 12:98184826-98184848 GTAGAGGGATGCAGGGATCTTGG - Intergenic
1102676642 12:114664041-114664063 GTGTAGGGGTGCAGGGGCCAGGG + Intergenic
1103206479 12:119133439-119133461 GGTCTGGGAAGCAGGGGTCTTGG - Intronic
1103907587 12:124335443-124335465 GTGCAGGGCTTCGGGGGCCTGGG + Intronic
1104207538 12:126654505-126654527 TTTCAGGGATACAGGGGTTTGGG - Intergenic
1104275090 12:127319740-127319762 GACCAGGGATGCAGGGCCCCTGG + Intergenic
1104624250 12:130338854-130338876 GTGCGGGGGTGCAGGGGCCGGGG + Intronic
1106136580 13:26978113-26978135 GTTCAAGGCTGCAGTGGGCTGGG - Intergenic
1106454984 13:29919270-29919292 GTTCAGGGCAGGAGGAGCCTGGG + Intergenic
1106559080 13:30833313-30833335 GTTCAGGTCTGCAGGGGCCAAGG - Intergenic
1107349126 13:39495874-39495896 CTTCAGGAATTCAAGGGCCTGGG + Intronic
1107890022 13:44905965-44905987 GATCTGGGAGGCAGGGGCCACGG + Intergenic
1108218889 13:48213131-48213153 GTTCAGGGCTGGAGGGGCAGAGG - Intergenic
1108615484 13:52128581-52128603 GTACTGGGTTGCAGGGGGCTGGG + Intronic
1113598228 13:111549076-111549098 TCTCTGGGATGCAGGCGCCTGGG + Intergenic
1113778835 13:112964090-112964112 GTGCAGGGTTGCAGGGGGCGGGG + Intronic
1116811111 14:49540995-49541017 GTACAGGGCTGCAGGGCCTTGGG - Intergenic
1118157682 14:63257284-63257306 GGTCAGGGATGCTGGGGACTGGG - Intronic
1119408458 14:74412923-74412945 GCTGAGGCATGCAGGGGCCTTGG + Intronic
1120827393 14:88968221-88968243 GCTGTGGGTTGCAGGGGCCTGGG - Intergenic
1122023823 14:98860044-98860066 GGCCAGGGCTGCAGGTGCCTGGG + Intergenic
1122258921 14:100500745-100500767 GTACTGCGAGGCAGGGGCCTGGG + Intronic
1122783829 14:104154915-104154937 GTGCTGGGCTGCAGGGGCCCTGG + Intronic
1123012434 14:105355949-105355971 GTTCAGGGGTCCAGGGGCTGCGG + Intronic
1125410849 15:39404760-39404782 CTTCAGGGATACAGGGTCCTGGG - Intergenic
1128346322 15:66854711-66854733 GTTCCAGGAGGCAGGAGCCTGGG + Intergenic
1128561648 15:68672711-68672733 GTTCTGGGATGGAGTGGCCTAGG + Intronic
1128812878 15:70585253-70585275 GTACCGGGAGGCAGGGGCCCGGG - Intergenic
1128920083 15:71602658-71602680 GTACAGGCTTGCAGGAGCCTTGG - Intronic
1129579448 15:76791778-76791800 ATTCAGGAATGCAGTGGCCTTGG + Intronic
1129984704 15:79907980-79908002 GGTAAGGGAGGCAGGGGTCTGGG + Intronic
1130380090 15:83364200-83364222 ATACAGGGAGTCAGGGGCCTGGG - Intergenic
1130990035 15:88870733-88870755 GGTCTGGGATCCAGGGGCCCTGG - Intronic
1131198891 15:90379690-90379712 GTGCAGGGCAGCAGGGCCCTGGG + Intergenic
1132501150 16:285248-285270 GTCCAGGGATGGGGGTGCCTAGG + Intronic
1132633319 16:930202-930224 GAACAGGGGTGCAGGGCCCTGGG + Intronic
1132676113 16:1121893-1121915 GCACAGGGATGCTGGGGCCTGGG + Intergenic
1132685982 16:1162305-1162327 GAGCAGGGGTGCAGGTGCCTGGG + Intronic
1132954571 16:2584849-2584871 TTTCATGTATGCAGAGGCCTGGG + Intronic
1132989312 16:2784936-2784958 GTTCAGGGAGGGAGGGTGCTGGG + Intronic
1132997228 16:2829661-2829683 GTTCAGGGACTCAGAGGCCATGG - Intergenic
1133229433 16:4359653-4359675 TTTCAGAGCTGAAGGGGCCTGGG + Intronic
1136276304 16:29181157-29181179 GCCAAGGGATGTAGGGGCCTGGG + Intergenic
1136672727 16:31873112-31873134 GCTCAGGGAAGAAGGGTCCTTGG - Intergenic
1137357399 16:47779837-47779859 GTTCTGGTAGGAAGGGGCCTGGG - Intergenic
1137464563 16:48696587-48696609 TTTCAGGGATGGAGGAGACTTGG + Intergenic
1137853584 16:51770798-51770820 CTTCTGGGATGCAAGGGGCTTGG + Intergenic
1139387334 16:66581151-66581173 GTCCAGGGATCCAGAGGTCTTGG + Intronic
1139660838 16:68419701-68419723 GTTCATGGAAGCTGGGCCCTGGG - Intronic
1140314106 16:73877213-73877235 GTTCAAGGAAGCAAGTGCCTGGG - Intergenic
1141579332 16:84986526-84986548 GTAAAGGGATGCAGGGCCCAGGG + Intronic
1142004271 16:87681839-87681861 GTGCTGGGATGCAGTGTCCTGGG + Intronic
1142080685 16:88147216-88147238 GCCAAGGGATGTAGGGGCCTGGG + Intergenic
1142621372 17:1167520-1167542 TTTCAGACATGCAGAGGCCTGGG + Intronic
1143502591 17:7347868-7347890 GTGCAGGGGGGCAGTGGCCTGGG - Intronic
1144418317 17:15072394-15072416 CTTCAGGGAAGAAGGGGCATGGG - Intergenic
1144729729 17:17519493-17519515 GTTCTTGGATCCCGGGGCCTGGG - Intronic
1144737019 17:17560923-17560945 GTTCAGGGATCCCAGGGCCCAGG - Intronic
1145060209 17:19728424-19728446 GTCCAGGCAGGCAGGGGCCTGGG + Intergenic
1147118848 17:38323260-38323282 GTTGGGGGAGGCAGGGGCCATGG + Intergenic
1147247514 17:39132055-39132077 ATTCAGGGATGCTGGGCCATGGG + Intronic
1148182950 17:45620208-45620230 GAAGAGGGATGCAGGTGCCTTGG - Intergenic
1148493529 17:48037989-48038011 GTTCGGGGATGTAAGGGACTCGG - Intronic
1150607689 17:66708173-66708195 GTTCAGGAATTCAGGGAACTCGG + Intronic
1151518456 17:74612430-74612452 GGGCAGGGAGGCAGGGGACTGGG + Exonic
1151890066 17:76946525-76946547 TTTCACGGGTGCAGGGCCCTGGG - Intronic
1152070688 17:78132315-78132337 GGTCAGGGAGGCCGGGGCCGGGG - Intronic
1152479796 17:80543074-80543096 CTTCAGGGATGCAGGGTCTTAGG - Intergenic
1152821145 17:82438512-82438534 CGTCAGGGGAGCAGGGGCCTGGG - Intronic
1154113128 18:11587405-11587427 CTTTAGGGGTGCAAGGGCCTTGG - Intergenic
1155991966 18:32287368-32287390 CTTCATGGTTGCAGGGACCTGGG - Exonic
1156352294 18:36311756-36311778 GTTGAGGCAGGCAGGGGCCAGGG - Intronic
1156622000 18:38864031-38864053 GTGCTGGGAAGCAGGGACCTGGG - Intergenic
1157206372 18:45703577-45703599 GTGCAGGGCTGCAGTGCCCTGGG + Intergenic
1157578304 18:48758522-48758544 GTACAGGGAAGCAGGGGCTTCGG + Intronic
1158184398 18:54754944-54754966 TGTCAGGGATGCAGGAGCCTAGG - Intronic
1158380897 18:56928620-56928642 GTGCAGGGATATAGTGGCCTGGG + Intronic
1158613906 18:58968523-58968545 GTTCAGGGAGGCACTGGCCTGGG - Intronic
1159955457 18:74515624-74515646 CTGCAGGGATGCAGGGGGCGGGG + Intronic
1160837345 19:1131170-1131192 GGTGAAGGATGCAGGAGCCTGGG - Intronic
1160959478 19:1712930-1712952 GTTCAGGGAGACAGTGGCCACGG + Intergenic
1161001866 19:1914678-1914700 TTTGGGGGACGCAGGGGCCTAGG + Intronic
1161021777 19:2014468-2014490 GTCCAGGGATGGAGGGGCCTGGG + Intronic
1161021819 19:2014580-2014602 GTCCAGGGATGGAGCGTCCTGGG + Intronic
1161849641 19:6731767-6731789 ATCCAGGGAGGCAGAGGCCTGGG + Intronic
1163216180 19:15879291-15879313 GTTGATGGGTGCAGGGGTCTGGG - Intronic
1163314252 19:16531568-16531590 GCTCAGGGGAGCAAGGGCCTGGG + Intronic
1164922297 19:32097539-32097561 GGTCTGGGATGCAGAGGGCTGGG - Intergenic
1165718344 19:38061641-38061663 GTACAGGGATGCAGAGGGGTAGG + Intronic
1165853992 19:38869298-38869320 GTGCAGGGAGGCGCGGGCCTCGG + Exonic
1165871261 19:38975302-38975324 GCGCAGGGATGGAGAGGCCTGGG + Intronic
1166743466 19:45128591-45128613 GACAAGAGATGCAGGGGCCTCGG + Intronic
1166913652 19:46179129-46179151 AGGCAGGGATGCAGGGGTCTGGG + Intergenic
1166918085 19:46209448-46209470 GTCCAGGGCTGCAGGAGCCCAGG + Intergenic
1167411633 19:49347536-49347558 CTGCAGGGCTGCAGGGGACTGGG - Intronic
1167574180 19:50309826-50309848 GTCCAGGGAGGAAGGGGGCTGGG - Exonic
1167708607 19:51097029-51097051 GGTCAGGGAAGGAAGGGCCTTGG - Intergenic
1168280486 19:55302876-55302898 GTACACGGGTGCAGGGGTCTTGG - Intronic
1168403515 19:56099215-56099237 GTTCACGGAGGAAGGGGCTTTGG - Intronic
1168520981 19:57050324-57050346 GTTCAGGGATACATGTGCCATGG - Intergenic
925187708 2:1860486-1860508 GGGCTGGGATGCTGGGGCCTGGG + Intronic
926154765 2:10447872-10447894 GCTCGGGGCTGGAGGGGCCTAGG - Intronic
927946428 2:27137696-27137718 GTTCAGGGACCCAGGGGCCCTGG - Exonic
931711424 2:64991494-64991516 GTTCGGGGATGCAGTGAGCTAGG - Intronic
932074023 2:68646339-68646361 GGTCAGGGAGGAAGGGGCATTGG + Intronic
932349928 2:71023464-71023486 TTTCTGGGCTGCAGTGGCCTGGG - Intergenic
933521535 2:83380870-83380892 GTCCAGGGCAGCAGGGCCCTGGG - Intergenic
935024310 2:99261589-99261611 AATCAGGCATGCAGGGGCTTGGG + Intronic
937963132 2:127478644-127478666 GTTCAAGGCTGCAGGGAGCTAGG + Intronic
937995456 2:127690860-127690882 GTGCAGGGCAGCAGGGCCCTGGG + Intergenic
939790602 2:146569666-146569688 GTTAAGGGATGGAGGCCCCTGGG + Intergenic
942089986 2:172480495-172480517 GTTCCGGGAGGGAGGGGCGTGGG - Intronic
942610940 2:177741961-177741983 GTTCAGGGCTGCAGTGAGCTAGG + Intronic
944211357 2:197209910-197209932 GTTGAGGGCTGCTGGGGACTGGG + Intronic
944516985 2:200522157-200522179 GTTCAGAGCTGCTGGGGCCTAGG - Intronic
946339089 2:219057024-219057046 GGTCAGGCATGCAGGTGTCTGGG + Intronic
948209849 2:236184924-236184946 GTGCAGGGCAGCAGGGCCCTGGG - Intergenic
948401949 2:237691577-237691599 GTGCAGCGGTGCTGGGGCCTAGG + Intronic
948577443 2:238963877-238963899 GTTGAGGACTGCAGGGTCCTGGG - Intergenic
948835065 2:240622381-240622403 TGTCAGGGAAGCAGGAGCCTGGG - Intronic
1168798523 20:628643-628665 CATCAGGGATGGAGGGGACTGGG - Intergenic
1169112627 20:3043751-3043773 GTTCAGGGGTGGAGGCACCTGGG - Intronic
1169144853 20:3245684-3245706 ATTTAGGAATGCAGAGGCCTGGG + Intergenic
1169589689 20:7126372-7126394 GTTCAAGGATGCAGTGAACTAGG + Intergenic
1171149208 20:22811979-22812001 TTTGAGGGATGCAGAGGCATAGG - Intergenic
1171339767 20:24418749-24418771 GTGCACAGAGGCAGGGGCCTGGG + Intergenic
1171489785 20:25508729-25508751 GTGCAGGGATGCAGGTGACTGGG - Intronic
1172028249 20:31964248-31964270 GGTCAGGGATGTGGGGGACTAGG + Intergenic
1172106726 20:32521616-32521638 GGACAGGGATGCAGAGGGCTGGG + Intronic
1172114759 20:32567109-32567131 AATCAGGGGTGCAGGAGCCTGGG + Intronic
1172442884 20:34978180-34978202 GCTCAGGGCTGAAGGGGCATTGG + Intronic
1172657714 20:36547103-36547125 TCTCAGGGGTTCAGGGGCCTGGG - Intronic
1172973408 20:38889526-38889548 GTGCAGGCATGCAGGGGCCCGGG - Intronic
1173181879 20:40812263-40812285 CTCCAGGGATGCTGTGGCCTGGG - Intergenic
1173377339 20:42498289-42498311 GTTCAGGAAGGCAGGGGGCAGGG + Intronic
1175300251 20:57937909-57937931 GTTCAGGGGAGCTGGGGCATGGG + Intergenic
1175698152 20:61117860-61117882 GCTGAGTCATGCAGGGGCCTGGG - Intergenic
1175904877 20:62374838-62374860 GTTCAGGCGGGCAGGTGCCTGGG + Intergenic
1175905996 20:62379738-62379760 GCTCCGGAATGCTGGGGCCTGGG + Intergenic
1175926590 20:62474340-62474362 GTCCAGGGAGGCGGGGGCCAGGG + Intronic
1176211995 20:63929154-63929176 CTCCAGGGCTGCAGGGGCCAGGG - Intronic
1177998446 21:28131381-28131403 GTGCAGGGCAGCAGGGCCCTGGG + Intergenic
1179677426 21:42993185-42993207 GTTGGGGGATGCACTGGCCTTGG + Intronic
1180032637 21:45222897-45222919 GCTGAGGGCTACAGGGGCCTGGG - Exonic
1182430673 22:30297179-30297201 GTTCAGGGCTGGAGGGGACAGGG + Intronic
1184988560 22:48152749-48152771 TTTCAGGCCTGCAGGGTCCTGGG - Intergenic
1185046241 22:48529981-48530003 GCTCATGGATGCAGGGGCTGTGG + Intronic
1185091593 22:48778650-48778672 GTGGAGGGATGCAGGGCCCTAGG + Intronic
1185253163 22:49816272-49816294 GTTCAAGGATGCAGTGACCTAGG + Intronic
949167280 3:958046-958068 GTTCAGCCATGCAGGGGTGTTGG - Intergenic
950791417 3:15475244-15475266 GCCCTGGGATGCAGGGGCATAGG - Intronic
950972427 3:17202623-17202645 GTGCAGGGTAGCAGGGCCCTGGG - Intronic
951269113 3:20603321-20603343 GCTCAGGGATCCAAGGGCTTTGG + Intergenic
951666808 3:25135084-25135106 GTTCAGGGAAGCATGGTCCTAGG - Intergenic
951938542 3:28051478-28051500 GTTCAAGAATCCAGGGGGCTGGG + Intergenic
952225282 3:31369135-31369157 TCTCAGGGATGCATGGGTCTGGG + Intergenic
953387765 3:42516360-42516382 GGTCAGGGAAGCAGGGGACGGGG - Intronic
953972697 3:47359510-47359532 GTGCAGGGCAGCAGGGCCCTAGG - Intergenic
955001713 3:54933348-54933370 GTTCAGGTTGACAGGGGCCTGGG + Intronic
955347685 3:58173237-58173259 GGTCAAGAAGGCAGGGGCCTAGG - Intergenic
956319467 3:67980493-67980515 GTTCAGTGATGCAGCTGTCTTGG + Intergenic
957792533 3:84959242-84959264 GTGCAGGGATGCCGGGGTGTTGG - Intronic
960563881 3:119114059-119114081 GTACAGGGCAGCAGGGCCCTGGG + Intronic
960708006 3:120499958-120499980 GTTCAGCCATGCAGGGGTGTTGG - Intergenic
960997740 3:123350931-123350953 TTTCAGGAATGCTGAGGCCTGGG + Intronic
961314959 3:126028280-126028302 GTGCAGGGCAGCAGGGGCCCTGG - Intronic
961445669 3:126980177-126980199 GCTGAGGGATGCAGGGGACATGG + Intergenic
961468131 3:127093680-127093702 GTTCATGGATGGAGGGCCCTGGG + Intergenic
962266794 3:133949547-133949569 GTTCAGAGCTGCAGGGCCTTAGG - Intronic
962811614 3:138963282-138963304 GCTCAGGGCTGCAGGCGGCTGGG - Intergenic
966097854 3:176228058-176228080 GTACAGGAAGGCAGGGCCCTGGG - Intergenic
967169819 3:186814242-186814264 GATCAGGGATGAAGGTGTCTGGG + Intergenic
967892895 3:194375610-194375632 GGTCAGGGATGGACGGGGCTGGG - Intergenic
967949595 3:194830566-194830588 ATCCAGGAATGCAGGAGCCTTGG - Intergenic
970168500 4:13264850-13264872 GTTGTGGGAGGCAGGTGCCTAGG - Intergenic
971013510 4:22464551-22464573 GATAAGGGATGCTGGGGCCATGG - Intronic
972908339 4:43779845-43779867 GTTCAGGGATGCAGTGGAGGAGG + Intergenic
973923908 4:55717482-55717504 GTTCTGGGGTGCTGGGGGCTGGG + Intergenic
977378289 4:96237251-96237273 GTGCAGGGAAGCATGGCCCTGGG - Intergenic
978267099 4:106839596-106839618 GTGCAGGGTGGCAGGGACCTGGG + Intergenic
980158581 4:129134105-129134127 GGTGGGGGATGCAGGGGCCAGGG + Intergenic
981704223 4:147642030-147642052 GAGCAGGAATGCAGGAGCCTAGG - Intronic
982184098 4:152779329-152779351 GCTCAGGGATGCCGGGCCCGGGG + Intronic
983542739 4:168930708-168930730 GTTGGGGGATGCAGGGGCATGGG - Intronic
983728620 4:170964387-170964409 TTTCAGGGATTCATGGCCCTGGG - Intergenic
983882799 4:172952183-172952205 GTTCATGGCTGCTGTGGCCTGGG + Exonic
984188289 4:176573237-176573259 GTTCACGGAGGCAGAGTCCTTGG - Intergenic
984201422 4:176725370-176725392 GTTCAGGGCTGCAGTGTGCTAGG - Intronic
984608653 4:181813306-181813328 GTTCAGGAAAGCAGAGCCCTTGG + Intergenic
985386345 4:189452181-189452203 GCACAGGGCAGCAGGGGCCTGGG - Intergenic
987289521 5:16495469-16495491 GTTCAGGGAAGAGGTGGCCTGGG - Intronic
987878652 5:23712266-23712288 GTTCCAGGCTGCAGGGGCCATGG - Intergenic
988592820 5:32563816-32563838 ATTCTGGGATGGAGGAGCCTGGG - Intronic
990225448 5:53647279-53647301 GTTCAGGGCTGCAGTGAGCTAGG - Intronic
995132724 5:108647515-108647537 GCTCAGGGAAGCAGGACCCTGGG - Intergenic
995469578 5:112486639-112486661 GTTCAGGGATGCAGTGAGCTAGG - Intergenic
997575903 5:134976966-134976988 GCTCAGGGCAGCAGGGCCCTGGG + Intronic
998004151 5:138646277-138646299 GAGCAGGGAGGCAGGGGCTTTGG - Intronic
998286989 5:140871815-140871837 GTTTAGAGATGAAGGGGCATGGG - Intronic
998457890 5:142287782-142287804 GTGCAGGGCTGCAGCTGCCTCGG + Intergenic
998525949 5:142843340-142843362 GTTCAGGGATGCAGGGACATGGG + Intronic
1000040309 5:157480332-157480354 ATACAGGGATGCAGGGGTTTGGG + Exonic
1001004579 5:168038948-168038970 GTTGAGGGCTGCTGGGGACTTGG + Intronic
1001124977 5:169011176-169011198 TTTCTGGGATGCTGGAGCCTGGG - Intronic
1001805406 5:174581342-174581364 GTTCAGTGCTGTAGGGGTCTCGG + Intergenic
1003349609 6:5303607-5303629 TTTCAGAGAAGCAGGGGGCTTGG - Intronic
1003383094 6:5642911-5642933 CTTCAAGGCTGCAGGGGACTGGG - Intronic
1004076260 6:12346689-12346711 GTTCAGGGTTGCAGGTGGCTGGG - Intergenic
1004565192 6:16789462-16789484 GTGCAGGGAATCAGGGCCCTGGG + Intergenic
1005994181 6:30921717-30921739 GTACAGGGGAGCGGGGGCCTGGG + Intronic
1007335513 6:41152350-41152372 CGTCAGGGAGGCAGGGACCTGGG - Intronic
1007361507 6:41360093-41360115 GTGCAGGGCAGCAGGGTCCTGGG - Intergenic
1007592003 6:43027506-43027528 GGACAGGGGTGCAGGGGCCATGG + Intronic
1009774968 6:68194702-68194724 GCTCAGGGATGCAAGGGCTGTGG - Intergenic
1010786032 6:80003029-80003051 GTTAAGTGATGCAGATGCCTTGG + Intergenic
1012039412 6:94185243-94185265 GTGCAGGGCTGCAGGGCTCTGGG + Intergenic
1013167266 6:107605342-107605364 GTGCTGGGGTTCAGGGGCCTCGG + Intronic
1013731527 6:113173808-113173830 GTTCAGCCATGCAGGGGTGTTGG - Intergenic
1015626625 6:135185654-135185676 GTTCAGACATGCAGGGGAATAGG + Intronic
1017663489 6:156696164-156696186 GTACAGGGATAGAGGGGCATTGG - Intergenic
1017903621 6:158739662-158739684 GTTCTGGGATGCAGTGAGCTAGG - Intronic
1018087922 6:160320982-160321004 GTTTAGGGATTCAGTGGCCAAGG + Intergenic
1018451332 6:163910931-163910953 GTTCAAGGATGCAGTGACCTAGG - Intergenic
1019005789 6:168795350-168795372 ATCCAGGGATGCAGGGTCATGGG + Intergenic
1019140842 6:169941195-169941217 GTCCAGGGATGCACCGGCCCTGG + Intergenic
1019478485 7:1255381-1255403 GTTCAGGGGTGCAGAGCCATGGG + Intergenic
1019636441 7:2078579-2078601 GTTCAGACATGGAGGGGCCCTGG - Intronic
1020282228 7:6655493-6655515 GCTCAGGGCTGCGAGGGCCTCGG - Exonic
1020428007 7:8091598-8091620 GGTCAGGTATCCAGGGGCGTTGG - Intronic
1021380030 7:19955540-19955562 GTGCAGGGAAGCAAGGCCCTAGG - Intergenic
1022093833 7:27125666-27125688 GTTTAGGGATGCAGAGACCAGGG + Intronic
1022102617 7:27177547-27177569 GGTCAGGGATGCTGGGGGCTAGG - Intronic
1022393469 7:29963498-29963520 GTTCAGTGTAGCTGGGGCCTAGG + Intronic
1022975373 7:35551092-35551114 GATCAGGGAGGCAGGCTCCTGGG - Intergenic
1024046552 7:45589397-45589419 GATGAGGGCTGCAGGGGCCTGGG - Intronic
1024710971 7:52014354-52014376 GTTTAAGGCTGTAGGGGCCTGGG + Intergenic
1024729188 7:52235702-52235724 GTGCAGGGTAGCAGGGTCCTTGG - Intergenic
1025144758 7:56493551-56493573 GAGCAGGGATGGAGGGTCCTGGG + Intergenic
1025281501 7:57629350-57629372 CTTCAGGGGCGCAGGAGCCTGGG - Intergenic
1025303229 7:57836165-57836187 CTTCAGGGGCGCAGGAGCCTGGG + Intergenic
1026385733 7:69845858-69845880 CTCCTGGGATGCAGGTGCCTGGG + Intronic
1026562481 7:71462012-71462034 CTTCAAGGATGCAGAGGTCTGGG + Intronic
1026892279 7:73989281-73989303 GTTCAAGGATGCAGGGACCTGGG + Intergenic
1027133078 7:75605236-75605258 GTTCGGGCCTGCAGGGGACTGGG + Intronic
1027413212 7:77944533-77944555 TGTCAGGTATCCAGGGGCCTAGG - Intronic
1029959168 7:104671076-104671098 GTTCAGCCATGCAGGGGTGTTGG + Intronic
1032193491 7:129777462-129777484 GTGGAGGGAGGCTGGGGCCTGGG + Intergenic
1032545376 7:132737550-132737572 ATACAGGGATAGAGGGGCCTGGG + Intergenic
1034405422 7:150899547-150899569 GTGGAGGGAAGCAGGTGCCTAGG - Intergenic
1034928184 7:155140356-155140378 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928197 7:155140404-155140426 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928202 7:155140420-155140442 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928221 7:155140484-155140506 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928230 7:155140516-155140538 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928247 7:155140580-155140602 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928252 7:155140596-155140618 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928261 7:155140628-155140650 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928266 7:155140644-155140666 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928275 7:155140676-155140698 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928280 7:155140692-155140714 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928289 7:155140724-155140746 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1034928294 7:155140740-155140762 GCTCAGGGATGCTGGGGCTCAGG - Intergenic
1035057252 7:156043839-156043861 GTTGATCGATGCCGGGGCCTGGG - Intergenic
1035164100 7:156974074-156974096 CTATAGGGATGCAGGTGCCTGGG - Intergenic
1035666466 8:1384188-1384210 GTTAAGGGATGAAGTGGCCTTGG + Intergenic
1035742493 8:1938907-1938929 GTTCAGGGTTTCTGGGGACTGGG - Intronic
1036499235 8:9297952-9297974 GCCTAGGGAAGCAGGGGCCTTGG + Intergenic
1036701189 8:11015082-11015104 GATCAGGGAAGCCGGGACCTGGG + Intronic
1037946136 8:22990787-22990809 GGCCTGGGATGCGGGGGCCTGGG - Intronic
1040860935 8:51998850-51998872 GGTGTGGGATGCAGAGGCCTTGG + Intergenic
1041117924 8:54558555-54558577 GCCCAGGGAGACAGGGGCCTGGG - Intergenic
1042610048 8:70588519-70588541 GTTCAAGGATGCAGTGAGCTAGG + Intronic
1042824194 8:72963634-72963656 CTTCAGGGATCCAAGGGCCTTGG - Intergenic
1046134073 8:110003942-110003964 GTGTAGGGCTGCAGGGCCCTGGG + Intergenic
1046635912 8:116675562-116675584 GTTCAGGGCTGGAGGGGTATTGG - Intronic
1048985061 8:139730757-139730779 GTGCAGGGATCCTGGGACCTGGG + Exonic
1049159551 8:141088752-141088774 ATTCAGAGTGGCAGGGGCCTAGG + Intergenic
1049339660 8:142105375-142105397 GTCCAGGGAAGCAGGGGCTGAGG - Intergenic
1049378002 8:142298194-142298216 GCTCAGAGATGGAGAGGCCTGGG - Intronic
1049426947 8:142541926-142541948 GTTCAGCACTGCAGGGGCCGCGG - Exonic
1049691077 8:143959457-143959479 GGTCCGGGATGCAGAGGCCCAGG + Intronic
1050935158 9:11386902-11386924 GCTCAGGGCAGCAGGGCCCTGGG - Intergenic
1052119227 9:24689374-24689396 GTTGAGTGATGGAGGTGCCTAGG - Intergenic
1052702212 9:31950884-31950906 GTTCAGAGTGGCAGGGTCCTGGG + Intergenic
1053147878 9:35724175-35724197 GTGCAGGTATGCAGAGGACTTGG - Exonic
1056581002 9:87888017-87888039 GTCCAGGGCAGCAGGAGCCTGGG + Exonic
1057261466 9:93587171-93587193 GGTGAGGGATGGAGGAGCCTCGG + Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1059256486 9:112935770-112935792 TTCCAGGGAAGCAGGAGCCTTGG + Intergenic
1061002010 9:127907942-127907964 GTTCATTGGTGAAGGGGCCTTGG - Exonic
1061220175 9:129245895-129245917 TTCCAGAGAGGCAGGGGCCTGGG + Intergenic
1061251956 9:129431631-129431653 GTTCAGGGAAGCATGGGCTCTGG - Intergenic
1061394176 9:130334218-130334240 ATGCAGGGATGCAGGGGAGTTGG + Intronic
1061478245 9:130883565-130883587 GTGCAGGGATGAAGAGGCCAGGG - Intronic
1061777573 9:132975894-132975916 GTCCAGGGCTGTAAGGGCCTGGG + Intronic
1062041978 9:134408413-134408435 GTGCAGGGAGGCAGGTGCCTGGG + Intronic
1062520486 9:136955721-136955743 GGGCAGGGATGGAGGGGCCTTGG - Intronic
1185948918 X:4408496-4408518 TTTTAGGGATCCAAGGGCCTTGG - Intergenic
1188964702 X:36536987-36537009 GTACAGGGCAGCAGGGCCCTAGG - Intergenic
1189656448 X:43249674-43249696 GTGCAGGGTAGCAGGGCCCTGGG - Intergenic
1191904324 X:66072982-66073004 GTTCAGCCATGCAGGGGTGTTGG - Intergenic
1192602088 X:72475583-72475605 GTTCAGGGATGCAGGGATTTGGG + Intronic
1192800633 X:74461908-74461930 TTTGAGGGATTCAGGGGCTTGGG - Intronic
1193399204 X:81021800-81021822 GCTCAGGGATTCAAGGCCCTTGG + Intergenic
1193526574 X:82598170-82598192 GCTCTGAGATGCAGGGGCATAGG - Intergenic
1193801865 X:85946402-85946424 GTGCAGGGAAGCAGGGCCCTGGG - Intronic
1194023885 X:88726888-88726910 GTTCAGGGCAGCAGGGCCTTTGG + Intergenic
1195035065 X:100965049-100965071 GTGCAGGGCAGCAGGGCCCTGGG - Intergenic
1195576768 X:106460403-106460425 AATGAGGGATGCTGGGGCCTGGG - Intergenic
1195715967 X:107819116-107819138 GTGCAGGGCAGCAGGGGCCCTGG - Intergenic
1197719134 X:129733117-129733139 GCTCAGGGCAGCAGGGCCCTAGG - Intergenic
1198873704 X:141201717-141201739 GTGCAGGGCAGCAGGGTCCTAGG - Intergenic
1199666077 X:150097544-150097566 TTTCAGGGAAGCCAGGGCCTAGG - Intergenic
1199694655 X:150335328-150335350 GTCCAGGTCTGCTGGGGCCTTGG + Intergenic
1200049721 X:153422355-153422377 GCTCAGGGATGATGGGGCCTGGG - Intergenic
1200149290 X:153943414-153943436 GTTCAGAGGTGAAGGGGACTTGG + Intronic
1201736017 Y:17262446-17262468 TTTTAGGGATCCAAGGGCCTTGG - Intergenic
1201947827 Y:19531098-19531120 GTGCAGGGAAGTAGGGTCCTGGG - Intergenic
1201982389 Y:19922217-19922239 ATTCAAGGGTGCAGTGGCCTGGG + Intergenic