ID: 1088790276

View in Genome Browser
Species Human (GRCh38)
Location 11:113219286-113219308
Sequence CCCTGGGTTTGTACTGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088790276_1088790283 26 Left 1088790276 11:113219286-113219308 CCTCATTCAGTACAAACCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1088790283 11:113219335-113219357 ACTGCATTAAGCAATCAGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 108
1088790276_1088790280 -5 Left 1088790276 11:113219286-113219308 CCTCATTCAGTACAAACCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1088790280 11:113219304-113219326 CAGGGCCCGCTTTTAAACACTGG 0: 1
1: 0
2: 1
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088790276 Original CRISPR CCCTGGGTTTGTACTGAATG AGG (reversed) Intronic
906539817 1:46576739-46576761 CACTGGATTTGGACTGAGTGTGG - Intronic
907976815 1:59438880-59438902 CCCTAGCTTTGTTCTGGATGAGG + Intronic
908127066 1:61042921-61042943 CCCTGGCTTTGCACAGAATGAGG - Intronic
917790377 1:178495592-178495614 CCCTGGGAATATAATGAATGAGG - Intergenic
918175452 1:182040550-182040572 CCCTGGGTTTGGACTGAGTCTGG + Intergenic
919170101 1:193942982-193943004 ACCTAGTATTGTACTGAATGGGG + Intergenic
921325658 1:213984561-213984583 ACCTGGATTTGTTCTGAATGGGG - Intronic
1066667100 10:37794397-37794419 CCCTATGAATGTACTGAATGTGG - Intronic
1066670443 10:37832114-37832136 CCCTATGAATGTACTGAATGTGG - Exonic
1067126815 10:43524702-43524724 CCCTGTGAATGTAATGAATGTGG + Intergenic
1069828388 10:71268125-71268147 CCCTTGGATTTTCCTGAATGTGG - Intronic
1070805613 10:79269032-79269054 CCCTGGGATTCTAGTGGATGTGG + Intronic
1078460437 11:11511144-11511166 CCCTCCTTTTGGACTGAATGAGG + Intronic
1079898083 11:26148186-26148208 CCCTGAGTTTTCACTGAAAGAGG - Intergenic
1080060126 11:27948313-27948335 CCCTGTGCTTGTGCTCAATGTGG + Intergenic
1081138932 11:39474052-39474074 CCCTGGGTTATTTCTGTATGTGG + Intergenic
1084456655 11:69271602-69271624 CCCTGGCTTGGCACTGAAGGAGG + Intergenic
1087470274 11:98565366-98565388 CCCTTTGTATGTACTGAGTGTGG - Intergenic
1087834278 11:102855883-102855905 CACTGGGTGTGTTCTGAATCAGG - Intergenic
1088432526 11:109774471-109774493 CCCTGGGGTTTGACTGGATGTGG - Intergenic
1088790276 11:113219286-113219308 CCCTGGGTTTGTACTGAATGAGG - Intronic
1089528552 11:119112417-119112439 CCCTGGGTGGGTACAGAGTGGGG + Intronic
1090663744 11:128901201-128901223 ACCTGGGTTTGAACTGACAGCGG - Exonic
1092704030 12:11264767-11264789 AACTGGGATTGAACTGAATGTGG + Intergenic
1092708031 12:11305926-11305948 AACTGGGATTGAACTGAATGTGG + Intergenic
1092884632 12:12914348-12914370 GCCTGGCTTTGTACTGAAAAGGG + Exonic
1093288999 12:17299660-17299682 CCCTGGGCCTGTACTGTAGGGGG + Intergenic
1094229023 12:28081460-28081482 CCCTGCTTTTATACTGAAAGGGG + Intergenic
1097747499 12:63316758-63316780 CCCTGGGTTTTTGCTGAAAGAGG - Intergenic
1101176793 12:102160338-102160360 CCCTGGTTTTGTACCCAATTAGG + Intronic
1105066353 12:133202593-133202615 CCCTATGGTTGTAATGAATGTGG + Intergenic
1105986650 13:25573723-25573745 CACTGGGTGTCTTCTGAATGGGG + Intronic
1110769375 13:79321262-79321284 CCATGAGTTTGAATTGAATGGGG - Intronic
1112805103 13:103156076-103156098 CCCAGGGTGTGTAATGAATGAGG - Intergenic
1119348214 14:73943614-73943636 CCCTGGGGCTGAACTGAAGGAGG - Intronic
1120382930 14:83805600-83805622 CCCTATGGTTGTAATGAATGTGG - Intergenic
1120642843 14:87036489-87036511 CACTGGTTTTGTGCTCAATGTGG + Intergenic
1121671855 14:95716252-95716274 CCATAGTTTTGTAATGAATGGGG + Intergenic
1129966337 15:79739144-79739166 CCTTGGGTCAGTAATGAATGGGG + Intergenic
1131154867 15:90068521-90068543 CCCTTCGTGTGCACTGAATGCGG + Exonic
1137364522 16:47849246-47849268 CCCTGGGCTTGGACTCAGTGGGG - Intergenic
1143198092 17:5092090-5092112 CCCTTTGCTTGTAATGAATGTGG + Exonic
1143502060 17:7345044-7345066 CCCTGGGTCTGGACAGAGTGAGG + Intronic
1150421825 17:65043573-65043595 CACTGCGCTTGGACTGAATGTGG + Intronic
1150505894 17:65698873-65698895 CCCTGGGCTTGCACTGAAGAGGG - Intronic
1152570961 17:81121076-81121098 CCCTGAGTTTGTGCTCAAGGAGG - Exonic
1153550101 18:6253463-6253485 CCCTAAGTATGTACTGAATCTGG - Intronic
1156620980 18:38851253-38851275 CCCTGTGTTGGAAATGAATGTGG + Intergenic
1156730148 18:40183942-40183964 CCCTGGGTTTGTCCTTGGTGGGG + Intergenic
1160621542 18:80174547-80174569 CCCTGAGTGTGAACTAAATGTGG - Intronic
1161187764 19:2933634-2933656 CCCTACGAATGTACTGAATGTGG - Exonic
1162239879 19:9342337-9342359 CACTATGTTTGTAATGAATGTGG + Exonic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164576570 19:29408747-29408769 CCCTGGGCTGGAGCTGAATGAGG + Intergenic
1165101340 19:33440372-33440394 CCCTGGGGTTGGAGTGGATGGGG - Intronic
1165276699 19:34759263-34759285 CCCTATGTTTGTAGAGAATGTGG - Exonic
1165506771 19:36237155-36237177 CCCTATGGTTGTAATGAATGTGG + Exonic
1165543604 19:36514142-36514164 CCCTATGGTTGTAATGAATGTGG - Exonic
1165555443 19:36627284-36627306 CCCTATATTTGTAATGAATGTGG + Exonic
1165565147 19:36719646-36719668 CCCTTTGTTTGCAATGAATGTGG + Exonic
1165565181 19:36719982-36720004 CCCTATATTTGTAATGAATGTGG + Exonic
1165565191 19:36720066-36720088 CCCTATATTTGTAGTGAATGTGG + Exonic
1165565215 19:36720318-36720340 CCCTATGTTTGTAATGAATGTGG + Exonic
1165565239 19:36720570-36720592 CCCTATGTTTGTAATGAGTGTGG + Exonic
1165589073 19:36950402-36950424 CCCTATGTATGTAGTGAATGTGG + Exonic
1165608463 19:37128579-37128601 CCCTATGTGTGTAATGAATGTGG + Exonic
1165610941 19:37151896-37151918 CCCTACATTTGTTCTGAATGTGG - Exonic
1165614310 19:37185534-37185556 CCCTACATTTGTTCTGAATGTGG - Exonic
1165643611 19:37412907-37412929 CCCTATGTATGTAATGAATGTGG - Exonic
1166024927 19:40073998-40074020 CCCTGTGAATGTACAGAATGTGG - Exonic
1167027412 19:46931013-46931035 CCCTCTGTAGGTACTGAATGAGG - Intronic
1167779374 19:51588087-51588109 CCCTATGTGTGCACTGAATGTGG + Exonic
1167816917 19:51890997-51891019 CCCTTTGTATGTCCTGAATGTGG - Exonic
1167822872 19:51945246-51945268 CCCTTTGTATGTACTGAGTGTGG + Exonic
925304312 2:2837841-2837863 ACCTGGGGTTATACTGAGTGAGG - Intergenic
926160639 2:10486977-10486999 CCCTGGGTTTGCACTACATTCGG - Intergenic
927285434 2:21352190-21352212 TCCTGTGTTTGTTCAGAATGAGG + Intergenic
930236096 2:48890150-48890172 CCCTGGGGTTGTACTGGCTTGGG + Intergenic
930934849 2:56936247-56936269 CCCTTGGTTTGCTTTGAATGTGG - Intergenic
931333410 2:61313681-61313703 CCTTGTGTTTTTAATGAATGTGG - Intronic
931376598 2:61713602-61713624 CCGTGGGTTTGGAGTGAATGAGG + Intergenic
932702091 2:73999108-73999130 CCATGGCTGTGTCCTGAATGAGG - Intronic
935638261 2:105267040-105267062 ACCTGGGTCTGGACTGCATGAGG + Exonic
936016824 2:108965692-108965714 CCCTGGGTGTGTAGTAATTGGGG + Intronic
936920805 2:117686581-117686603 CCCTGGGTTTATACTTTATATGG - Intergenic
937601425 2:123739993-123740015 CCCTTGGTTTGTACAGGCTGTGG - Intergenic
937990304 2:127658564-127658586 CCCTGGGGCTGGACTGATTGCGG - Intronic
941182395 2:162275230-162275252 CCCTTGGTTTGAAATGAATAAGG + Intronic
948175411 2:235939073-235939095 CTCTGGGTTTATACAGAATCAGG - Intronic
948685555 2:239667557-239667579 CCCTCGGCTGGTACTGAATGAGG - Intergenic
1172896000 20:38300406-38300428 CTCTGGGTTTGGACTGGATAGGG - Intronic
1175480544 20:59307599-59307621 ACCTGGGTCAGTATTGAATGGGG + Intronic
1175684696 20:61020129-61020151 CACTGTGTTTGTTCTTAATGAGG + Intergenic
1176078057 20:63257952-63257974 GCCTGCGTTTGTGCTGACTGGGG - Intronic
1179457619 21:41509803-41509825 GCCTGGGATGGGACTGAATGGGG - Intronic
1182281139 22:29218324-29218346 CCCTGGTTTTCTGCAGAATGGGG + Intronic
1184677508 22:46051800-46051822 CCCTGGGTTTGGGCTGAGCGCGG + Exonic
950113274 3:10434278-10434300 CTCTGGGTTTCTACAGATTGGGG + Intronic
952957368 3:38565488-38565510 GCCTGGGTTTGCACTCACTGAGG - Intronic
956530891 3:70217259-70217281 ATCTACGTTTGTACTGAATGGGG - Intergenic
957165711 3:76670409-76670431 CCATGGGTTTGTAAAGAATGAGG + Intronic
958634316 3:96723534-96723556 CCCAGGGTCAGTACTGAAAGAGG - Intergenic
964310122 3:155383533-155383555 CCCTGTGTGAGTACTGACTGTGG + Intronic
966163951 3:176996072-176996094 CCCTGTATTTGTAATGGATGTGG + Intergenic
968922535 4:3530125-3530147 CCCTACGTTTGAACTGACTGTGG + Intronic
970721627 4:18995751-18995773 CCCAGGGTTTCAACTGAATGAGG - Intergenic
971382687 4:26113402-26113424 CCCTATGAATGTACTGAATGGGG + Intergenic
973212040 4:47626698-47626720 ACCTGTGTTTGAACTGCATGAGG + Intronic
974974551 4:68874124-68874146 CCCTGGGTTCCTACTGTCTGTGG - Intergenic
976654703 4:87476481-87476503 CCCTGGGTTTGTATTTAAGATGG - Intronic
980085086 4:128382592-128382614 CGATGCGTTTGTACTGAATAGGG + Intergenic
984261711 4:177451014-177451036 CCCTGAATTTGTCCTGAATTTGG - Intergenic
988885462 5:35552690-35552712 TTCTGGGTTTATACTGCATGGGG - Intergenic
990278838 5:54228362-54228384 CCCTGGGTTTATGCAGAATTTGG - Intronic
990347091 5:54881836-54881858 CCGGTGGTGTGTACTGAATGTGG - Intergenic
991976534 5:72188779-72188801 CCCAGGGTTTATACTTATTGGGG + Intronic
995518330 5:112976273-112976295 CCAAGGGTTTGTAGTGAAAGAGG + Intergenic
995521308 5:113008675-113008697 CCCTGGGTATTTACTTAATTTGG + Intronic
998134451 5:139667427-139667449 CACTGGGTTAGCACTCAATGTGG + Intronic
1000754710 5:165143987-165144009 CCCTGTGTTTGCTCTGCATGTGG - Intergenic
1001877033 5:175210545-175210567 ATAAGGGTTTGTACTGAATGGGG + Intergenic
1002866793 6:1129123-1129145 CCCTGTGTTTGGACTGCATTTGG - Intergenic
1006357998 6:33572096-33572118 CCCTGCGTGTGTGCTGACTGTGG + Intergenic
1006612476 6:35302661-35302683 CCCTGGGTTTGTGGAGACTGTGG + Intronic
1016297993 6:142596723-142596745 CCCTGGCTTTCTACTCACTGTGG - Intergenic
1019874427 7:3796563-3796585 GCCTGGCTATGTACTGAAAGTGG - Intronic
1020287012 7:6690942-6690964 CCCTATGAGTGTACTGAATGTGG - Exonic
1028053684 7:86217330-86217352 CCCTGTGTTTGTAGTCATTGAGG - Intergenic
1029174601 7:98655752-98655774 TTCTGGGTTTGTTCTGAAAGTGG + Intergenic
1029217997 7:98965665-98965687 CCGTGGGTTTGTTCTTAATTGGG + Intronic
1031276708 7:119733133-119733155 CCCCTGGTTTGGACTGAATGAGG - Intergenic
1032240235 7:130154221-130154243 CCCTGGGTTTGTGGTGTATGTGG - Intergenic
1033653175 7:143356952-143356974 CCCAGGGTATGTACTGTCTGGGG - Exonic
1036372697 8:8174600-8174622 CCCTGGACTTGTACTGTAGGAGG + Intergenic
1036878207 8:12491041-12491063 CCCTGGACTTGTACTGTAGGAGG - Intergenic
1043867534 8:85393186-85393208 CCCTGAGTTGGTCCTCAATGAGG + Intronic
1044217979 8:89635381-89635403 CCCTGATTCTGAACTGAATGAGG - Intergenic
1045180060 8:99770986-99771008 CCCTGGGTTTGAAATCAATCAGG + Intronic
1049832082 8:144707422-144707444 CCCTGTGTATGTATTGAATGTGG + Intergenic
1049832117 8:144707720-144707742 CCCTGTGTGTGTAGTGAATGTGG + Intergenic
1049834099 8:144722344-144722366 CCCTATGTTTGTAATGAGTGCGG - Exonic
1049834106 8:144722428-144722450 CCCTATGTATGTAATGAATGCGG - Exonic
1049865235 8:144931135-144931157 CCCTATGAATGTACTGAATGTGG - Exonic
1053558406 9:39162474-39162496 CTTTGGGTGTGTACTCAATGGGG - Intronic
1053822521 9:41982699-41982721 CTTTGGGTGTGTACTCAATGGGG - Intronic
1054138708 9:61456468-61456490 CTTTGGGTGTGTACTCAATGGGG + Intergenic
1054608055 9:67204667-67204689 CTTTGGGTGTGTACTCAATGGGG + Intergenic
1054946394 9:70800481-70800503 ACATGGGTTTGAACTGCATGGGG + Intronic
1057156561 9:92846610-92846632 CCCTATATTTGTAATGAATGTGG - Exonic
1057156598 9:92847030-92847052 CCATATGTTTGCACTGAATGTGG - Exonic
1057156641 9:92847534-92847556 CCTTATGTATGTACTGAATGTGG - Exonic
1057252381 9:93514450-93514472 CCTTGGGTTTGTTTTAAATGTGG - Intronic
1057633231 9:96738099-96738121 CCCTTTGAATGTACTGAATGTGG + Intergenic
1058828374 9:108794602-108794624 CCCTGGGTTTTCACTGAAAGAGG + Intergenic
1059263032 9:112997448-112997470 CCCTATGTTTGTAAAGAATGTGG - Intergenic
1061879151 9:133560057-133560079 ACATGGGTTTGGATTGAATGGGG - Intronic
1186288871 X:8074738-8074760 ACATGGGTTTGAACTGCATGAGG + Intergenic
1189242503 X:39536452-39536474 CCCCGGGTTTGTGCTGATGGAGG - Intergenic
1190088017 X:47412806-47412828 CCCTATGAATGTACTGAATGTGG + Exonic
1190092096 X:47447932-47447954 CCGTACGTTTGTCCTGAATGCGG - Exonic
1190148068 X:47916303-47916325 CCCTATGTTTGTGCTGATTGTGG + Exonic
1190164276 X:48059216-48059238 CCCTATGAATGTACTGAATGTGG - Exonic
1198036504 X:132806085-132806107 CTCTGGGTTGGTTGTGAATGTGG - Intronic