ID: 1088790364

View in Genome Browser
Species Human (GRCh38)
Location 11:113220311-113220333
Sequence GAGAATGCACAGATGGTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088790364_1088790370 20 Left 1088790364 11:113220311-113220333 CCACATACCATCTGTGCATTCTC 0: 1
1: 0
2: 0
3: 20
4: 211
Right 1088790370 11:113220354-113220376 CTCCCTCAACCACTTCCATTTGG 0: 1
1: 0
2: 1
3: 19
4: 213
1088790364_1088790367 -7 Left 1088790364 11:113220311-113220333 CCACATACCATCTGTGCATTCTC 0: 1
1: 0
2: 0
3: 20
4: 211
Right 1088790367 11:113220327-113220349 CATTCTCTGCTGTTAAGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088790364 Original CRISPR GAGAATGCACAGATGGTATG TGG (reversed) Intronic
901114984 1:6836292-6836314 GAGAAACCACAGATGGGTTGGGG + Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
902722842 1:18315592-18315614 GTGGATGGACAGATGGTAGGTGG + Intronic
903576648 1:24343491-24343513 GAGATTGCACAGCTAGTAAGTGG + Intronic
905105550 1:35561490-35561512 GTGAGTGCACATATGGTGTGTGG - Intronic
905677746 1:39840559-39840581 GGGAATGCAGAGATGAGATGTGG - Intergenic
906162919 1:43664041-43664063 GAGAATGCTCATACGGTGTGGGG + Intronic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
909593895 1:77382687-77382709 AAGAATCCACAGATGGTTGGTGG - Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
912027936 1:105202906-105202928 GGGAAGGGACTGATGGTATGTGG - Intergenic
914322520 1:146578870-146578892 AAGAGTGCACAGGTGGAATGTGG - Intergenic
915236324 1:154485761-154485783 GAGAATGCAAAATTGGTATTGGG - Intronic
919272808 1:195371952-195371974 GAGATTGCACAGCTAGTAAGTGG + Intergenic
919609090 1:199722831-199722853 GAGAATGCACAGCTGCTAAAAGG - Intergenic
919777223 1:201202133-201202155 GAGAAAGCTCAGATGGAAAGGGG - Intronic
921957538 1:220999845-220999867 GAGAAAGTACAGATGGCATCAGG + Intergenic
923406030 1:233661551-233661573 AAGGAGGCACAGATGGTAAGAGG - Intronic
1063246807 10:4228914-4228936 GAAAATGCACACGTGGTTTGAGG - Intergenic
1064252243 10:13715452-13715474 GAGAATACACAGCCGGTAAGTGG - Intronic
1065065446 10:21959020-21959042 CAGAATGCATGGAAGGTATGAGG + Intronic
1065731709 10:28715363-28715385 AAGAATGCAGAACTGGTATGTGG + Intergenic
1066625171 10:37398624-37398646 GAGTATGCACAAATGGCAGGTGG + Intergenic
1067275970 10:44834447-44834469 GAGAATGAAAAGAGGATATGTGG + Intergenic
1068665268 10:59668259-59668281 AGGAATGCACAGATGGTGTGAGG - Intronic
1070452611 10:76577279-76577301 GAGAATCCACAGGAGGAATGAGG + Intergenic
1070821287 10:79356211-79356233 GAGAATGCACAGGTGCCTTGGGG + Intergenic
1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG + Intergenic
1071543816 10:86512094-86512116 GATAAAGTACAGATGATATGAGG - Intronic
1073741037 10:106407366-106407388 GTGAATATACAGCTGGTATGTGG + Intergenic
1075247075 10:120832239-120832261 GAGAATCCACAAATGCTTTGAGG + Intergenic
1075896785 10:126003044-126003066 GAGAATGGCCAGATGAAATGTGG - Intronic
1078125720 11:8560857-8560879 GAGAATGCATAGCTGCTATGTGG + Intronic
1078238402 11:9507344-9507366 GAGAATACAAATATGGAATGGGG - Intronic
1079943567 11:26713101-26713123 GAGTGGGCACAGATGGTATTAGG - Intronic
1081297991 11:41415321-41415343 GTGAATGGACAGAAGGTTTGAGG + Intronic
1081396856 11:42596384-42596406 GTGAATGATCAGATAGTATGGGG - Intergenic
1086054834 11:82634480-82634502 GAGAACGCACAGCTGGCAAGCGG + Intergenic
1086753656 11:90531181-90531203 GAGCATGCATAGATGGTAATGGG - Intergenic
1088047310 11:105469967-105469989 TTGCATGCATAGATGGTATGTGG + Intergenic
1088790364 11:113220311-113220333 GAGAATGCACAGATGGTATGTGG - Intronic
1089320252 11:117621188-117621210 GACAATGCACAGCTAGTAAGTGG - Intronic
1092205274 12:6611017-6611039 GGTAATGCAGAGATGGCATGAGG - Intergenic
1093773136 12:23040290-23040312 GATTATGCACAGATGCTATAAGG - Intergenic
1094552799 12:31468881-31468903 GAGAATGCACAAACAGTATTAGG + Intronic
1095869738 12:47013234-47013256 AAGAATGGCAAGATGGTATGGGG + Intergenic
1095956638 12:47810314-47810336 GAGGTCACACAGATGGTATGTGG + Intronic
1096746952 12:53735271-53735293 TGGAATGCACAAATGTTATGTGG - Intergenic
1097502063 12:60416107-60416129 CAGAAAGAACACATGGTATGGGG + Intergenic
1099194098 12:79594605-79594627 GAGAATGCACAGGAGATATTAGG + Intronic
1099272320 12:80526126-80526148 GAGAAAGCACAGATAGGATGGGG - Intronic
1099756241 12:86853730-86853752 GAGAATGCAAAGCAGGTATTTGG - Intergenic
1099883917 12:88503451-88503473 GGGAATGCACAGAAGAAATGAGG + Intronic
1100080501 12:90843242-90843264 GAAAATGCACATATTGTATTTGG + Intergenic
1100183057 12:92106496-92106518 GAGAATGCACAAATGACTTGGGG + Intronic
1100346317 12:93734934-93734956 GAGAAAGCACATATGGTACAGGG - Intronic
1101452389 12:104791194-104791216 GAGAATGCATAGAATATATGTGG - Intergenic
1102396339 12:112589270-112589292 GAGAAAGCACAGTTTGTAAGAGG - Intronic
1103871003 12:124091756-124091778 GAGATTGGAGAGATGGGATGAGG + Intronic
1105638142 13:22236039-22236061 GAGAATACAAAGAAGATATGTGG + Intergenic
1106988315 13:35383380-35383402 GAGAGTGAACAGATGGAATAGGG + Intronic
1107950551 13:45457545-45457567 GAGAATTAACAGATTGTATTTGG - Intergenic
1108895458 13:55321417-55321439 GAGAATAAATAGATAGTATGAGG + Intergenic
1110162150 13:72391153-72391175 GATAATGAACAGATATTATGTGG + Intergenic
1110268289 13:73564691-73564713 GAGTATGAACAAATGGTATGAGG + Intergenic
1112345979 13:98589821-98589843 AAAAATGCAGAGATGGTTTGAGG - Intergenic
1113265866 13:108617369-108617391 CAGAATGCATAGAAGGAATGAGG - Intronic
1114811969 14:25911532-25911554 GAGAAGGCACAGGTATTATGTGG - Intergenic
1115344193 14:32324794-32324816 GAGAATGCAGAGATGGAAAAAGG + Intergenic
1115515163 14:34177775-34177797 AAGGATGCAAAGATGGAATGTGG + Intronic
1116119758 14:40707023-40707045 GTTAATGCACATATGGTAAGTGG + Intergenic
1118564562 14:67125204-67125226 TAGAATGCAGAGGTGGAATGTGG + Intronic
1118661216 14:68015036-68015058 AAGATTGCACAGATGGCAGGAGG - Intronic
1118711785 14:68525517-68525539 GAGAATTCCCAGATGGTCAGTGG - Intronic
1120969448 14:90195188-90195210 GAGAATGAACAGATCGTATCTGG + Intergenic
1121124868 14:91399475-91399497 GAGAATGCACAGGTGTTGGGAGG - Intronic
1121637708 14:95465100-95465122 GAGAATGGACAGAGGGACTGGGG + Intronic
1122000394 14:98646103-98646125 GTGAATGAGCAGAAGGTATGAGG - Intergenic
1122278878 14:100609824-100609846 CAGAAGGCACAGAGGGGATGAGG + Intergenic
1122384417 14:101334169-101334191 GTGAATGCACAGTTGGGACGTGG - Intergenic
1125152808 15:36552402-36552424 AAGATTGCACAGCTTGTATGTGG - Intergenic
1125208444 15:37182322-37182344 GGGAATGAACAGAAGGGATGTGG + Intergenic
1125421744 15:39511234-39511256 GGAAATGGAGAGATGGTATGGGG + Intergenic
1126057757 15:44747780-44747802 GAGAATGTAGACATGGAATGAGG + Intronic
1126362251 15:47858647-47858669 CAGAATTCACAGCTGGTTTGGGG - Intergenic
1126511636 15:49481994-49482016 GAGAATGAAGTGAAGGTATGGGG + Intronic
1128512235 15:68320413-68320435 GAGACTGGGCAGATGGAATGAGG + Intronic
1128903702 15:71448985-71449007 GAGAATGAACAGAAGGCAAGGGG - Intronic
1129021352 15:72522139-72522161 GAGAATACAAAGATGAGATGTGG + Intronic
1130141263 15:81228215-81228237 GAGAATGGCTAGATGGCATGGGG + Intronic
1130793412 15:87181046-87181068 GAGAATGCACACCTGGTATCTGG + Intergenic
1133745946 16:8686874-8686896 GAATATGAACTGATGGTATGTGG + Intronic
1137929155 16:52570288-52570310 GAGGCTGCAAAGATGGTTTGAGG - Intergenic
1138262878 16:55637987-55638009 GGGAATGGACAGATGGGATACGG + Intergenic
1139094112 16:63684218-63684240 GAGGATGCACATAAGCTATGAGG - Intergenic
1139415570 16:66805782-66805804 AAGAATGCAGCAATGGTATGTGG + Exonic
1140011103 16:71132305-71132327 AAGAGTGCACAGGTGGAATGTGG + Intronic
1140590611 16:76347819-76347841 GAGAAGGTAGAGATGATATGGGG + Intronic
1141751771 16:85962942-85962964 GAGAAAGGACAGATGGTTAGAGG - Intergenic
1143153658 17:4822537-4822559 GGGTATGGAGAGATGGTATGGGG + Intronic
1144143718 17:12376687-12376709 GAAAAGGAAAAGATGGTATGCGG + Intergenic
1145019345 17:19417364-19417386 TGGAATGCACAGATGGGAAGAGG + Intergenic
1149454247 17:56774879-56774901 AAGATTGCACAGATGGTAAGTGG - Intergenic
1149502489 17:57164707-57164729 GTGAAGGCAAAGATGGTATCTGG - Intergenic
1149725341 17:58887584-58887606 GAGAATGCTCAGCAGGTTTGAGG + Intronic
1151436216 17:74099463-74099485 GAGGGTGCAGAGATGGTCTGGGG - Intergenic
1152408264 17:80109514-80109536 GAGGAAGCACAGATGAGATGTGG + Intergenic
1153642900 18:7171199-7171221 GAGATTGCTCAGATTGCATGTGG - Intergenic
1154487824 18:14891226-14891248 GAGAATGAAGTGAAGGTATGGGG - Intergenic
1155807237 18:30187027-30187049 GAGAACGCACAGACTGTCTGTGG - Intergenic
1156677267 18:39543005-39543027 GAGGAAGCACAGATGTTAGGAGG + Intergenic
1158497891 18:57973201-57973223 CAGAATGCACAGGTGCTGTGGGG + Intergenic
1160442413 18:78902679-78902701 GAGCAAGCACAGATGCTCTGAGG - Intergenic
1161679969 19:5675107-5675129 TGGAATGCAGAGATGGTGTGGGG + Intronic
1162548743 19:11346613-11346635 GAGCATGAACAGGTGGTATGTGG + Exonic
1164592151 19:29512979-29513001 GAGAAAGGACAGAGGGGATGAGG + Intergenic
1164674276 19:30091345-30091367 GAGAATGCATAAAGGGTAAGGGG + Intergenic
1165601986 19:37061472-37061494 GATAATTCACTGATGCTATGCGG + Intronic
1166214085 19:41324492-41324514 GAGAAGGGTCAGATGGTAGGCGG + Exonic
1166713032 19:44949131-44949153 GAGAAAGCACAGATGGTTAGAGG - Intronic
1167368564 19:49067179-49067201 GAGAAGGTACAGATGGTGAGAGG - Intergenic
1167875942 19:52412552-52412574 GAGAATGCCCTGATTGTTTGAGG + Intronic
925722920 2:6845719-6845741 GGGAAGCCACAGATGGTATTAGG - Intronic
926473142 2:13286433-13286455 CAGAATACACAGTTGCTATGTGG - Intergenic
927443490 2:23137419-23137441 GTGATTGGACAGAGGGTATGAGG - Intergenic
928121863 2:28589582-28589604 TAGAATCCACAGATAGTGTGTGG + Intronic
931121375 2:59223966-59223988 CAGAATTCACAGATGGTAAGTGG - Intergenic
932725600 2:74177390-74177412 GTGAATGCACAGTTGCTTTGTGG - Intronic
932835526 2:75032312-75032334 GAGAAGGCACAGAAGTTTTGAGG - Intergenic
933512319 2:83256625-83256647 GAGATTTCACTGATGGTAGGGGG + Intergenic
936950577 2:117973900-117973922 GAGTATGCAGAGAAGGTAGGTGG - Exonic
942547215 2:177077695-177077717 AAGAATTCACAGATGTGATGAGG - Intergenic
942839309 2:180340388-180340410 GAGTATGCAAAGATGGTAGAGGG + Intergenic
943743646 2:191438185-191438207 GAGAAAGCAGAGATGGAGTGCGG - Intergenic
946680621 2:222211336-222211358 GAAAATGCACAGCTAGTAAGTGG + Intronic
947564899 2:231187486-231187508 GGAAATGCACAGATGGCATGAGG + Intergenic
1169336681 20:4762603-4762625 GAGAATGCAATGAGGGCATGGGG + Intergenic
1173448518 20:43141654-43141676 GGGTATGGACAGATGGTAAGGGG + Intronic
1175251182 20:57611003-57611025 GGGAATGCAGAGATGGGCTGGGG - Intronic
1176793457 21:13348110-13348132 GAGAATGAAGTGAAGGTATGGGG + Intergenic
1178082945 21:29084107-29084129 ATGAATTCACAGATGGTTTGGGG + Intronic
1179252506 21:39683975-39683997 GAGAATGCAGTGGTGGGATGGGG + Intergenic
950359481 3:12440437-12440459 AAGGTTGCACAGATAGTATGCGG - Intergenic
953101375 3:39832099-39832121 GAGAATGCACACAGGGTGAGAGG - Intronic
953138145 3:40201575-40201597 GGAATTGCACAGAAGGTATGGGG - Intronic
953162434 3:40433646-40433668 GGGGATGCACAGATGGTTTCAGG + Intergenic
960882146 3:122355947-122355969 GAGAATGCACAGATGTTCAGAGG + Intergenic
960990196 3:123305139-123305161 GAGACTTCAGAGATGGGATGCGG - Intronic
962927816 3:140011556-140011578 GAGAATACACAGATGCTACCTGG + Intronic
965740519 3:171869606-171869628 GGAAATAGACAGATGGTATGTGG - Intronic
970851537 4:20609438-20609460 GAAAATGCACAGAAAGTAAGAGG + Intronic
971318703 4:25588220-25588242 GAGAATGGACAGAAGGGAGGGGG - Intergenic
971468078 4:26987185-26987207 GAGAATGAAGAGATTGTAAGGGG - Intronic
973209980 4:47604952-47604974 GAGAATGAACATATGGTGTAGGG - Intronic
974515799 4:62908317-62908339 TAGCATGCACAGGTGGTGTGAGG + Intergenic
976516414 4:85972723-85972745 GAGAATTAAGAGAGGGTATGGGG - Intronic
979495387 4:121377471-121377493 AAGAATGCACAGGTTATATGTGG - Intronic
981303099 4:143212760-143212782 TAGAATGCAGAGAAGATATGAGG + Intronic
981467968 4:145096125-145096147 AAGAATGCACACATTGTATCAGG + Intronic
981648661 4:147029682-147029704 GTGATTGCACAGATGGTGGGAGG - Intergenic
983873684 4:172851645-172851667 GAGAATGCACAGAAGATAAAAGG + Intronic
985638694 5:1053031-1053053 CAGAATGCACAGCTGCTGTGGGG + Intronic
987325726 5:16810410-16810432 GAGAAAGGACAGATGGGCTGAGG - Intronic
987692268 5:21282605-21282627 CTGAATGCAAAGATGGAATGAGG - Intergenic
988018699 5:25595963-25595985 GAGAATCCTCAGGTGGAATGGGG + Intergenic
988921646 5:35947779-35947801 GGGAATGCAAAGATGATATTTGG - Intergenic
989123779 5:38031384-38031406 AAGAATGGGCAGATGGTTTGAGG + Intergenic
991414424 5:66377679-66377701 GAGAATGCATCTATTGTATGAGG - Intergenic
991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG + Intergenic
991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG + Intergenic
991828925 5:70662745-70662767 CTGAATGCAAAGATGGAATGAGG - Intergenic
991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG + Intergenic
992223357 5:74594376-74594398 GAGAAAGCACAGATGTGACGGGG - Intergenic
994340807 5:98625578-98625600 GAGAGTGCCCAGAGGATATGAGG - Intergenic
994639785 5:102393163-102393185 GAGAATGCACAGAAGGGATAAGG - Intronic
994687182 5:102969961-102969983 GAGGAAGCACAGATGATAGGTGG + Intronic
996831127 5:127741554-127741576 GAGAATTCACAGATGTTATCAGG + Intergenic
998745370 5:145252391-145252413 AAGATTGCACAGATGGCTTGAGG - Intergenic
999373743 5:151072103-151072125 GAGAATACACAGCTGGTTAGTGG + Intronic
1000195315 5:158951518-158951540 GATAATGCACAGATTCAATGGGG + Intronic
1002705606 5:181159506-181159528 GAGAAAGCACAGACAGCATGGGG + Intergenic
1004180349 6:13375949-13375971 GAGAATGCAGATATGATATTGGG + Intronic
1006730239 6:36230896-36230918 GAGATTGCCCAGATGGCAAGAGG + Exonic
1007741134 6:44010336-44010358 GAGAAAGCTGAGAAGGTATGGGG - Intergenic
1013430500 6:110051083-110051105 TAGAATGCAGACATGGTAAGTGG + Intergenic
1014795257 6:125717510-125717532 AAGAATGCAAAGAAGGTCTGTGG + Intergenic
1015037364 6:128672361-128672383 TAGAGTGGACAGATGGCATGGGG + Intergenic
1015649778 6:135443775-135443797 GAGAATGCAGAGAAAGGATGGGG - Intronic
1018800593 6:167219246-167219268 GAGGATTCACAAATGGTGTGAGG - Intergenic
1018809572 6:167288105-167288127 GAGGATTCACAAATGGTGTGAGG + Intronic
1018995197 6:168705124-168705146 TAGAATGCAGAGATGGGGTGAGG - Intergenic
1021277661 7:18674423-18674445 GAGAAATCACAGATGGCATATGG - Intronic
1023279862 7:38558271-38558293 GGCAATGCACTGATGGTTTGGGG + Intronic
1023708788 7:42969920-42969942 GAGTGTGAAAAGATGGTATGGGG - Intergenic
1023845075 7:44115988-44116010 GAGAAGGAACAGATGCTAGGTGG + Intronic
1028674912 7:93447917-93447939 GAGAATGCAGATTTGGAATGTGG + Intronic
1032182141 7:129689492-129689514 GAGAATACACAAGGGGTATGAGG - Intronic
1032616496 7:133478007-133478029 CAGAATGCCCAGATGGAATCAGG + Intronic
1036465752 8:8995327-8995349 GAGAATGCACAGAGGATTTTCGG + Intergenic
1039545015 8:38403635-38403657 AAGAATGCACAGATGATCTTAGG + Intronic
1039779209 8:40767379-40767401 GAGAATACACAGAGGTTGTGGGG - Intronic
1041661646 8:60406936-60406958 GAGAATGCAGAGGTGGAAAGAGG - Intergenic
1042288568 8:67141889-67141911 GATAATGAACAGACGTTATGTGG - Intronic
1043194870 8:77279360-77279382 ATGAATGCAGAGATGGTATTTGG - Intergenic
1045746554 8:105429577-105429599 CAGAATGCACAGATTAAATGAGG - Intronic
1046171759 8:110517348-110517370 AAGAACACACAGATGGTAAGTGG - Intergenic
1046402785 8:113728119-113728141 GAGAATGCACAGGCAGTATTTGG + Intergenic
1047057833 8:121186950-121186972 GGGAGTGCACAGATGGTTTGGGG + Intergenic
1047359990 8:124160452-124160474 GAGAATGGGGAGATGGGATGGGG - Intergenic
1047515086 8:125546998-125547020 GAGAGAGCACAGATGGTTTCAGG + Intergenic
1047548072 8:125839148-125839170 GGGAATGCACAGTTGTTGTGGGG - Intergenic
1048232677 8:132659200-132659222 GGGAAGACACAGATGGTCTGCGG - Intronic
1050765110 9:9123210-9123232 GACATGGCACAGATGGCATGAGG - Intronic
1052198746 9:25751095-25751117 GAAAATGCACAGAGCCTATGAGG - Intergenic
1053164289 9:35833704-35833726 CAGAATGCACAGCTAGTAGGTGG - Intronic
1053225360 9:36350502-36350524 GAGAATCAACAGATGGTCTGTGG - Intronic
1053401361 9:37826623-37826645 GAGAATGCACAGGTGAAATGTGG + Intronic
1053621170 9:39820050-39820072 GAGAATGAAGTGAAGGTATGGGG - Intergenic
1054262991 9:62887387-62887409 GAGAATGAAGTGAAGGTATGGGG + Intergenic
1056061795 9:82890872-82890894 GAGAAGGGATAGATGGCATGAGG - Intergenic
1056280068 9:85032861-85032883 GAGAAGGCAAATATGGTGTGAGG - Intergenic
1058132399 9:101267609-101267631 GTGAATGAAGAGATGGTTTGTGG + Intronic
1058839962 9:108896488-108896510 GAGAAGTCACAGAAGGTATGTGG - Exonic
1060004721 9:119989849-119989871 AAGAATGAACAGAAAGTATGAGG + Intergenic
1060120350 9:120983407-120983429 GAGAGTGAAGAGATGTTATGGGG - Intronic
1188856689 X:35205096-35205118 GAGATTACACAGCTGGTAAGTGG + Intergenic
1189090757 X:38080178-38080200 GAGCATGCACAGCTGGTAAAAGG + Intronic
1190597303 X:52062395-52062417 CAGAATGTACTGATGGTATCTGG + Exonic
1190611521 X:52191678-52191700 CAGAATGTACTGATGGTATCTGG - Exonic
1196984935 X:121258720-121258742 GAGAATGCAAATATGTTATGTGG + Intergenic
1198666860 X:139033976-139033998 CAGAATGCTCAGACAGTATGTGG - Intronic
1200411763 Y:2868283-2868305 CAGAGTGCAGAGATGGTATTGGG + Intronic