ID: 1088791448

View in Genome Browser
Species Human (GRCh38)
Location 11:113230781-113230803
Sequence CCACATGCCTAGACTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088791445_1088791448 13 Left 1088791445 11:113230745-113230767 CCAGATCACTAACTTTCTTGAGG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1088791448 11:113230781-113230803 CCACATGCCTAGACTCTTCCTGG 0: 1
1: 0
2: 2
3: 10
4: 148
1088791443_1088791448 21 Left 1088791443 11:113230737-113230759 CCCTTTCTCCAGATCACTAACTT 0: 1
1: 0
2: 2
3: 43
4: 336
Right 1088791448 11:113230781-113230803 CCACATGCCTAGACTCTTCCTGG 0: 1
1: 0
2: 2
3: 10
4: 148
1088791444_1088791448 20 Left 1088791444 11:113230738-113230760 CCTTTCTCCAGATCACTAACTTT 0: 1
1: 0
2: 0
3: 36
4: 313
Right 1088791448 11:113230781-113230803 CCACATGCCTAGACTCTTCCTGG 0: 1
1: 0
2: 2
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088791448 Original CRISPR CCACATGCCTAGACTCTTCC TGG Intronic
900902249 1:5525044-5525066 CCACATGCCCAGAGGCTTCTAGG - Intergenic
904033446 1:27547243-27547265 CCACATCCCCAGACTCACCCAGG + Exonic
905338811 1:37264367-37264389 CCACATTCTCAGACTTTTCCTGG + Intergenic
905453408 1:38071427-38071449 CCACAGTCCTAGACTCCTGCTGG - Intergenic
909115103 1:71523611-71523633 CCAGATGCTTGGACTCTGCCTGG - Intronic
910449833 1:87334026-87334048 CCACTTGCCTAAACTTGTCCTGG - Intronic
913701952 1:121382772-121382794 CCTCATGCTTCGACTGTTCCAGG - Exonic
914042509 1:144063241-144063263 CCTCATGCTTCGACTGTTCCAGG - Intergenic
914135578 1:144897247-144897269 CCTCATGCTTCGACTGTTCCAGG + Exonic
914340560 1:146756257-146756279 CCCCATGCCTGGGCTCCTCCAGG + Intergenic
915892719 1:159786225-159786247 CCACTTGCCAAGACTTTTCCTGG + Intergenic
917618392 1:176769366-176769388 CGACATGGCAAGACTCCTCCAGG - Intronic
920424926 1:205867399-205867421 CCCCATCCCTAGACACATCCTGG - Intergenic
920489375 1:206401492-206401514 CCTCATGCTTCGACTGTTCCAGG - Exonic
923445912 1:234071140-234071162 CCAGGTCCCTAGACTCTGCCGGG - Intronic
924628990 1:245719629-245719651 CCAAATGCCTGGAGTTTTCCAGG - Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063912527 10:10846478-10846500 TCACATACATAGACTCTTCTGGG - Intergenic
1065156112 10:22871818-22871840 CCCTATCCCTAGACTCCTCCGGG + Intergenic
1065525096 10:26612074-26612096 TCACCTGGCTAGACTCATCCTGG + Intergenic
1065829429 10:29600964-29600986 CCACATACATAGACACTCCCTGG + Intronic
1066986816 10:42475616-42475638 CCACGTGCCTGCACTCTCCCTGG + Intergenic
1068862779 10:61864885-61864907 ACACATGCCTAGACTGCACCCGG - Intergenic
1069657701 10:70102312-70102334 CCACAGGCCCAGACTCATCTTGG - Intronic
1073906438 10:108285943-108285965 CCACATGCATAGATTCTACAGGG - Intergenic
1075158891 10:120005302-120005324 CCACATGCCTGTACTGTACCTGG + Intergenic
1075466469 10:122655227-122655249 CCAGATCCTTAAACTCTTCCTGG + Intergenic
1076210152 10:128634065-128634087 CCTCATGCCTAGCCGCTCCCTGG + Intergenic
1077301925 11:1851479-1851501 CCACCTGCCTGTCCTCTTCCTGG + Intergenic
1077424522 11:2468063-2468085 CCACGTGCTTAGACTGTGCCCGG + Intronic
1077818037 11:5707423-5707445 CCACATCTCTGGCCTCTTCCTGG + Intronic
1079887435 11:26005025-26005047 CCCCATCCCTAGACACATCCTGG + Intergenic
1080769264 11:35325443-35325465 CACCATGCCTAGCATCTTCCTGG + Intronic
1083842285 11:65311335-65311357 CCACATGCCTTGCCACTTCTAGG + Intergenic
1084442346 11:69181854-69181876 CCAGATGCCCCGACTCTGCCTGG - Intergenic
1084510184 11:69598426-69598448 CCACCTGTCCAGACCCTTCCAGG - Intergenic
1087603759 11:100348907-100348929 CCACATGGTTACAGTCTTCCTGG - Intronic
1088791448 11:113230781-113230803 CCACATGCCTAGACTCTTCCTGG + Intronic
1090587937 11:128234421-128234443 CCACATGCGAAGACACTTGCAGG + Intergenic
1092303885 12:7279809-7279831 CCACCTGCCTGCATTCTTCCTGG - Intergenic
1093573497 12:20696653-20696675 CCACTTGAATAGATTCTTCCAGG - Intronic
1098875250 12:75860248-75860270 GCTCATACCAAGACTCTTCCAGG + Intergenic
1104422674 12:128650245-128650267 CCACATGCCTGGACCCTTGTAGG + Intronic
1104422930 12:128652047-128652069 TCACATGCCTGGACCCTTGCAGG + Intronic
1104520260 12:129467674-129467696 CCACATGCCTAAATTCTTTCTGG - Intronic
1108584518 13:51858676-51858698 CCACAAGCCTAATCTTTTCCTGG - Intergenic
1108940440 13:55946975-55946997 CCACATGCCTAATTTTTTCCTGG + Intergenic
1110216520 13:73030340-73030362 CCACCAGCCTAGTCTATTCCTGG + Intergenic
1119838280 14:77770739-77770761 TCACATCTCTAGACTCTTCTTGG + Intergenic
1120260033 14:82172128-82172150 ACACATGCCTAGCCTCCCCCAGG + Intergenic
1121557472 14:94849259-94849281 TCACCGGCCTAGACTCCTCCTGG + Intergenic
1122296841 14:100710583-100710605 GCACATGCCTAGACGCTTCCGGG - Intergenic
1123151268 14:106184166-106184188 CCATATGAATAGACTCTCCCTGG - Intergenic
1123399675 15:19972052-19972074 CCATATGAATAGACTCTCCCTGG - Intergenic
1125822271 15:42642187-42642209 CAAGATGCCTATACTATTCCAGG + Intronic
1126323158 15:47447013-47447035 CCTCATGCCTGGCCTCTTTCTGG + Intronic
1127073778 15:55307099-55307121 CCCCATCCCTAGACACATCCTGG - Intronic
1127390488 15:58501240-58501262 CTATATACCTAGACTCTTTCTGG + Intronic
1128554679 15:68623399-68623421 CCACATGCATGGACACTGCCAGG - Intronic
1129601491 15:77001393-77001415 CCACAGGCCCTGACCCTTCCAGG - Intronic
1130138265 15:81199556-81199578 GCACATGCCAAGACTCAGCCAGG - Intronic
1133747385 16:8697504-8697526 GCTCATGCCTGGACTGTTCCGGG - Intronic
1135116032 16:19724144-19724166 CCACAAGCTTTGTCTCTTCCTGG + Intronic
1139993725 16:70961149-70961171 CCCCATGCCTGGGCTCCTCCAGG - Intronic
1145070318 17:19800109-19800131 CCACAGTCTGAGACTCTTCCTGG + Intronic
1151511601 17:74564308-74564330 CCACTGGTCCAGACTCTTCCAGG - Intergenic
1156264120 18:35470526-35470548 ACACATGCCTACACTCTGCTCGG - Intronic
1156629251 18:38947078-38947100 CCACATTGATAGACTCTTTCAGG - Intergenic
1158446163 18:57523527-57523549 CCATATGCCTTGAGTCTTTCAGG - Intergenic
1158904187 18:61995842-61995864 CCACATGCCTTTCCTCTTCCTGG + Intergenic
1159331648 18:67002421-67002443 CCACACACCTTGACTCTACCTGG + Intergenic
1161959443 19:7515907-7515929 CCCCATCCCTAGTCTCCTCCTGG - Intronic
1162385702 19:10359376-10359398 CCACATGCCAAGTCCCTCCCTGG - Intronic
1162399283 19:10435126-10435148 CCCAAGGCCTAGACTCTCCCTGG + Intronic
1162755269 19:12854408-12854430 CCACATGCCTGGCCTTTTTCTGG + Intronic
1163660717 19:18575518-18575540 CCACACACCTAGACACTTCAGGG - Exonic
1164720089 19:30425579-30425601 CCACCCGCTTAGACTCTTCTTGG + Intronic
1164920337 19:32084350-32084372 CCCGATGCCTAGACACTCCCTGG - Intergenic
1165062542 19:33211866-33211888 CCACAGACCCAGAGTCTTCCTGG + Intronic
925170442 2:1746965-1746987 CCACATGCCATCACTCTTGCAGG + Intergenic
929316346 2:40483638-40483660 CCACATGACTAGGTTCTGCCTGG + Intronic
930406889 2:50969997-50970019 CTATCTGTCTAGACTCTTCCTGG + Intronic
931370744 2:61660462-61660484 CCACATGCCAAGTCTCTTCTAGG - Intergenic
936615296 2:114042184-114042206 CCACAGGCTTAAAATCTTCCAGG - Intergenic
938560954 2:132471447-132471469 CCACATACTTTGACTCTACCAGG - Intronic
1170804322 20:19616657-19616679 CCAGATGATTAGACACTTCCTGG - Intronic
1172802690 20:37588977-37588999 CCACATGCCTAGAGTATCTCTGG - Intergenic
1174306253 20:49616121-49616143 CCACAGGACTAGACTCTTGTGGG + Intergenic
1175851795 20:62097704-62097726 CCTCATGCCCACCCTCTTCCTGG - Intergenic
1178132299 21:29587634-29587656 GCAAATGTCTAGACTTTTCCTGG + Intronic
1182096905 22:27631452-27631474 CCACATGCATACTCCCTTCCAGG - Intergenic
1182739678 22:32558669-32558691 GCAGGTGCCTAGTCTCTTCCTGG + Intronic
1183696626 22:39427346-39427368 CCACATGCCTAATCTCTTCCAGG - Intronic
1185186884 22:49406694-49406716 CCACACTCCTACACTCTTTCTGG - Intergenic
949303675 3:2614806-2614828 CTCCAGGCCTAGTCTCTTCCTGG - Intronic
951004368 3:17599529-17599551 CCATATGACTTGATTCTTCCTGG + Intronic
955662209 3:61313108-61313130 GCAGATTCCTGGACTCTTCCAGG + Intergenic
956919708 3:73913953-73913975 TGACATGCCATGACTCTTCCAGG - Intergenic
960836921 3:121916290-121916312 CCACATCCCTCTTCTCTTCCAGG - Intronic
963920706 3:150902220-150902242 CCAGATGCCTAGGCTGGTCCTGG + Intronic
966026645 3:175292292-175292314 CCACTTGCCTAAAGTCTTCGAGG + Intronic
967180264 3:186897141-186897163 CCATATGAATAGACTCTCCCTGG + Intergenic
969134150 4:5016563-5016585 CCACATAGATAGACTCTGCCAGG - Intronic
969325336 4:6440869-6440891 CCACTTCCCTACACCCTTCCTGG - Intronic
972900595 4:43677644-43677666 CCACATGCCAAGCATCTTCTAGG - Intergenic
977028349 4:91849597-91849619 CCACATAGATGGACTCTTCCTGG + Intergenic
977310006 4:95374231-95374253 CCATATGCCTAGATACTTCAAGG + Intronic
979414942 4:120425584-120425606 CCACATACCTGGACCCTTTCTGG + Intergenic
980185783 4:129459229-129459251 CCTCATTCCCATACTCTTCCTGG - Intergenic
981775477 4:148362162-148362184 CCACATGTCTTGAATTTTCCAGG - Intronic
986310243 5:6545886-6545908 CCACCTGCTTTGACTCTCCCTGG - Intergenic
987216410 5:15742472-15742494 CCACATGCCTACACTGTTCTGGG - Intronic
987580671 5:19787209-19787231 CCACCTGCCTTGGCTCTGCCAGG - Intronic
987831771 5:23104643-23104665 CCACATGGCAAGCCTCTTCAGGG - Intergenic
988511316 5:31867035-31867057 CTCCATGCCTTGACTCTGCCTGG + Intronic
990537036 5:56733114-56733136 CCACCTGCCGCCACTCTTCCTGG + Intergenic
991963066 5:72064985-72065007 CCACATGCCTAGTCTCCCCAGGG + Intergenic
992506395 5:77391385-77391407 CTACAAGCAGAGACTCTTCCTGG - Intronic
994998364 5:107094585-107094607 CCACGTGACTTGATTCTTCCTGG - Intergenic
996756849 5:126944667-126944689 CCACATTCCTTTACTCTTCAAGG - Intronic
998606941 5:143645215-143645237 CCACATTCTCAGACTGTTCCAGG + Intergenic
1002647650 5:180668903-180668925 TCACACGCCTAGTGTCTTCCTGG - Intergenic
1004415934 6:15424061-15424083 CCGCATTCCTAAACTCTTTCTGG + Intronic
1004516674 6:16327227-16327249 CCACGTGCCTGGACTCGTACGGG + Exonic
1006139718 6:31920936-31920958 CCCCATGCCCAGGCTCTTCCAGG - Intronic
1010267064 6:73879091-73879113 AGACATGCCAAGACTCTTTCAGG - Intergenic
1012182143 6:96167542-96167564 CCACATGTCTAGACATTTTCTGG - Intronic
1012843901 6:104365363-104365385 CCACATGCCAGGAATCTTGCAGG + Intergenic
1013607218 6:111761593-111761615 CCACCTCTCTAGAATCTTCCAGG - Intronic
1015403638 6:132814038-132814060 CTACATGCTTTCACTCTTCCAGG - Intergenic
1015566395 6:134576024-134576046 CCACATGCATAACATCTTCCTGG - Intergenic
1018904125 6:168065225-168065247 GCACAGGCCCACACTCTTCCTGG + Intronic
1020998997 7:15303935-15303957 CCACAGACCTATTCTCTTCCAGG - Intronic
1023994002 7:45147458-45147480 CCACCTGCCTAGGAGCTTCCTGG - Intergenic
1031471830 7:122176048-122176070 CCCCATCCCTAGACACATCCTGG + Intergenic
1033039647 7:137906160-137906182 CCACATCCCTAGAGATTTCCTGG + Intronic
1035468136 7:159093015-159093037 CCACCTGCCTTGACTCCCCCAGG - Intronic
1043432505 8:80208562-80208584 CCACATGGCTTGAGTCTGCCTGG - Intronic
1044588094 8:93886634-93886656 CTACTTGCCGACACTCTTCCAGG - Intronic
1052342392 9:27376878-27376900 CCACAGGCCTAGAATATTCCTGG + Intronic
1053120192 9:35540514-35540536 TCACATTCCTAGACACTTCCTGG - Intronic
1055884246 9:81040357-81040379 CCAAATGGCTAGACACTGCCTGG + Intergenic
1056310365 9:85334595-85334617 CCAAATGCCTGAACTCTGCCAGG - Intergenic
1056844573 9:90025929-90025951 CCTCCTGCCTAGGCTCCTCCTGG + Intergenic
1057883546 9:98810623-98810645 CCACTTGGTTTGACTCTTCCTGG + Intronic
1062119736 9:134827820-134827842 CCACATCCCGGGACTCTTCCAGG + Intronic
1062518605 9:136948027-136948049 GCTCAGGCCTAGAGTCTTCCCGG - Intronic
1062599556 9:137313724-137313746 CCTCAGGCCTTGACTCCTCCTGG - Intronic
1185826507 X:3256303-3256325 TCACATGCCCAGAATTTTCCTGG - Intergenic
1185969743 X:4649260-4649282 CCGAATGCCAAGACTCTTCAAGG + Intergenic
1186611217 X:11139744-11139766 TCATATGCCTAGACTCTGACAGG + Intronic
1186772354 X:12830477-12830499 CCACATTCCTAGCCTTTTCCTGG - Intergenic
1187929290 X:24279387-24279409 CATCATGCTTAGCCTCTTCCTGG - Intergenic
1189434867 X:40983121-40983143 TAACATGCTTAGACTCCTCCTGG - Intergenic
1190118987 X:47645071-47645093 CCACAAACCTAGACTCACCCTGG - Intronic
1190713081 X:53083233-53083255 CCAGATGCGAAGACCCTTCCTGG + Exonic
1192400203 X:70827142-70827164 CCACATTTCTAGACACATCCTGG + Intronic
1196528083 X:116750646-116750668 CCCAATGCCTGGAATCTTCCTGG + Intergenic
1198927494 X:141815123-141815145 CCACACTCCTAGACACTCCCAGG - Intergenic
1200096324 X:153665799-153665821 CCACATGCCCAGACAGTGCCTGG + Intergenic
1201321968 Y:12709214-12709236 CACCATGCCCAGACTCTTACTGG + Intronic