ID: 1088798275

View in Genome Browser
Species Human (GRCh38)
Location 11:113283013-113283035
Sequence GAGGGTAAGTCAGGGGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088798267_1088798275 28 Left 1088798267 11:113282962-113282984 CCTCTCATGTTCCTGACACATTT No data
Right 1088798275 11:113283013-113283035 GAGGGTAAGTCAGGGGTTGCTGG No data
1088798269_1088798275 17 Left 1088798269 11:113282973-113282995 CCTGACACATTTTCGTGGAGCTA No data
Right 1088798275 11:113283013-113283035 GAGGGTAAGTCAGGGGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088798275 Original CRISPR GAGGGTAAGTCAGGGGTTGC TGG Intergenic
No off target data available for this crispr