ID: 1088799611

View in Genome Browser
Species Human (GRCh38)
Location 11:113293519-113293541
Sequence CAACAGAGGAAGGCGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088799611_1088799619 -7 Left 1088799611 11:113293519-113293541 CCCTCCCCCGCCTTCCTCTGTTG No data
Right 1088799619 11:113293535-113293557 TCTGTTGCCTATCACAGAGAAGG No data
1088799611_1088799620 -6 Left 1088799611 11:113293519-113293541 CCCTCCCCCGCCTTCCTCTGTTG No data
Right 1088799620 11:113293536-113293558 CTGTTGCCTATCACAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088799611 Original CRISPR CAACAGAGGAAGGCGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr