ID: 1088803148

View in Genome Browser
Species Human (GRCh38)
Location 11:113325632-113325654
Sequence CTCACTGACCTGGGCTCGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088803148_1088803157 -3 Left 1088803148 11:113325632-113325654 CCAACCGAGCCCAGGTCAGTGAG 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1088803157 11:113325652-113325674 GAGGCAGGGATGTATCCATGGGG 0: 1
1: 0
2: 1
3: 13
4: 202
1088803148_1088803156 -4 Left 1088803148 11:113325632-113325654 CCAACCGAGCCCAGGTCAGTGAG 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1088803156 11:113325651-113325673 TGAGGCAGGGATGTATCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 135
1088803148_1088803155 -5 Left 1088803148 11:113325632-113325654 CCAACCGAGCCCAGGTCAGTGAG 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1088803155 11:113325650-113325672 GTGAGGCAGGGATGTATCCATGG 0: 1
1: 0
2: 0
3: 18
4: 220
1088803148_1088803161 29 Left 1088803148 11:113325632-113325654 CCAACCGAGCCCAGGTCAGTGAG 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1088803161 11:113325684-113325706 GGAATAGTTGCCACTAAACTTGG 0: 1
1: 0
2: 0
3: 5
4: 74
1088803148_1088803159 8 Left 1088803148 11:113325632-113325654 CCAACCGAGCCCAGGTCAGTGAG 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1088803159 11:113325663-113325685 GTATCCATGGGGCTTTCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 129
1088803148_1088803162 30 Left 1088803148 11:113325632-113325654 CCAACCGAGCCCAGGTCAGTGAG 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1088803162 11:113325685-113325707 GAATAGTTGCCACTAAACTTGGG 0: 1
1: 0
2: 0
3: 5
4: 98
1088803148_1088803158 7 Left 1088803148 11:113325632-113325654 CCAACCGAGCCCAGGTCAGTGAG 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1088803158 11:113325662-113325684 TGTATCCATGGGGCTTTCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088803148 Original CRISPR CTCACTGACCTGGGCTCGGT TGG (reversed) Exonic
900208242 1:1440607-1440629 CTCACTGCCCTGGGGTCCGTGGG + Exonic
900401647 1:2475230-2475252 CTCCCTGTCCTGGGCTCTGCAGG + Intronic
901055620 1:6447573-6447595 CTCACTGAGCTGGGCCTAGTTGG + Intronic
902478768 1:16701064-16701086 CTCACTGAGCTGGGCCTAGTTGG - Intergenic
903968963 1:27106836-27106858 GTCACAGACCTGGGTTCTGTGGG + Intronic
906246603 1:44279943-44279965 CTCACTGAACAGGGCTGGGTAGG + Intronic
906608517 1:47187097-47187119 CTCCCAGACCTGGGCACTGTGGG - Intronic
907276439 1:53319448-53319470 CCCACAGCCCTGGGCTCGCTGGG + Intronic
918084360 1:181232582-181232604 CTCACTAGGCTGGGCGCGGTGGG + Intergenic
920417673 1:205809737-205809759 CCTACTGAGCTGGGCTCGGCAGG + Intronic
924560525 1:245154285-245154307 ATCACAGACCGGGGCTCGGGCGG + Intergenic
1070756723 10:78997938-78997960 CACACAGACCTGGGCTCACTTGG - Intergenic
1070773872 10:79098806-79098828 CTCACAGGCCTGTCCTCGGTAGG - Intronic
1071500676 10:86202118-86202140 CTCGCAGACCTGGGATGGGTTGG - Intronic
1075409544 10:122217198-122217220 GTCACTGACCTGGACTCGCTTGG + Intronic
1077077821 11:709231-709253 CTGACTGGCCTGGCCTGGGTGGG - Intronic
1079709090 11:23658631-23658653 CTCACTGAACTAGGCACAGTGGG - Intergenic
1080146908 11:28996857-28996879 CCCACTGACCTGGATTAGGTAGG - Intergenic
1081364883 11:42222477-42222499 ATCACATACCTGGGCTCGTTGGG + Intergenic
1085315110 11:75540046-75540068 CTCCCTGACATGGGCAGGGTGGG + Intergenic
1088803148 11:113325632-113325654 CTCACTGACCTGGGCTCGGTTGG - Exonic
1091549890 12:1529750-1529772 CTTTCTGAGCTGGGCTCTGTAGG + Intergenic
1102576788 12:113860744-113860766 CCCCCTGACCAGGGCTCTGTGGG + Intronic
1112459415 13:99590165-99590187 TTCGCTGACCTGGGCTGGGCTGG + Intergenic
1118589823 14:67392919-67392941 CTCACTGACCTTGGCCCTCTGGG + Intronic
1119398868 14:74348747-74348769 CTCCTTGACCTGGGCCCAGTAGG - Intronic
1122767630 14:104082788-104082810 CCCACTGACCTGGGCACTGTGGG + Intergenic
1123071366 14:105644059-105644081 CTGGCTTACCTGGGCACGGTGGG + Intergenic
1123091026 14:105742332-105742354 CTGGCTTACCTGGGCACGGTGGG + Intergenic
1124354609 15:28985403-28985425 CTCTCTGACCTCGGCTTGTTAGG - Intronic
1125608167 15:40953823-40953845 CTCACTCCCCTGGGCACGGTTGG - Intronic
1126041140 15:44592283-44592305 CTCACTGATCTGCACTTGGTTGG - Intronic
1127455867 15:59155585-59155607 CTCACTGGCCTCAGCTAGGTTGG - Intronic
1127732885 15:61816547-61816569 CTCACTGTCCTGGGCTGTGAAGG - Intergenic
1128152301 15:65371014-65371036 CAAACAGACCTGGGCTTGGTGGG - Intronic
1128181852 15:65611516-65611538 CTCACTCCCCTGGGCCCCGTCGG + Intronic
1128551047 15:68598171-68598193 CTCAGTGCCCTGGGCTCTGTAGG + Intronic
1134220448 16:12349289-12349311 CTCTTTGACCTTGGCACGGTGGG - Intronic
1137670607 16:50276135-50276157 CCCTCTGACCTGGGTTGGGTGGG + Intronic
1141511726 16:84516679-84516701 CTCCCTGAGCTAGGCTCCGTGGG + Intronic
1141725365 16:85784646-85784668 TGCACTGACCAGGACTCGGTGGG + Intronic
1142608383 17:1094918-1094940 CTCACCCACCTGGGCTTGGGGGG - Intronic
1142768909 17:2082572-2082594 CTCAATGGCCTGGGCAGGGTAGG + Intronic
1147450403 17:40500662-40500684 TTCACTGACCTGGGCTCATTGGG - Intronic
1147570054 17:41564571-41564593 CTTACATACCTGGGCTCGCTGGG - Intergenic
1149386797 17:56150475-56150497 CTCACTTAGCTGGCCTCTGTAGG + Intronic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1161171507 19:2814539-2814561 CACACTGACCTGGGCTGGGTGGG - Exonic
1161586122 19:5106829-5106851 CTCACTGCTCTGGGCTGGGCTGG - Intronic
1161652245 19:5492545-5492567 CTCGCAGCCCTGGGCTCGGAGGG + Intergenic
1163302754 19:16458070-16458092 CACACTGCCCAGGACTCGGTTGG + Intronic
1163556090 19:17993546-17993568 CCCACTCACCTTGGCTAGGTCGG - Exonic
1164705973 19:30320606-30320628 CTCTCTGACGGGGGCTCCGTGGG - Intronic
1167271649 19:48509568-48509590 CCCACTGACCTGGGGTGTGTTGG - Intronic
1167715114 19:51138050-51138072 CTCACTGAGCTGGTCTCAGGAGG + Intergenic
1202712787 1_KI270714v1_random:26895-26917 CTCACTGAGCTGGGCCTAGTTGG - Intergenic
925104847 2:1282659-1282681 CTCACTGACGTGGGGGCGGGGGG - Intronic
932401216 2:71482309-71482331 CTCACTGGCCTGGGCTGGGCCGG - Intronic
934682062 2:96291265-96291287 CCCTCTGACCTGGGCTAGCTGGG + Intronic
944210049 2:197197723-197197745 CTCAATTTCCTGGGCTCAGTTGG - Intronic
946430827 2:219626731-219626753 CTCACAGTCCTGTGCTAGGTTGG - Intergenic
946655248 2:221939275-221939297 CTCACTGACTTTGGCTCTGCAGG - Intergenic
1169808189 20:9580801-9580823 CTCCCTGATCTGGGGTGGGTGGG + Exonic
1170870933 20:20205674-20205696 CTGTCTGACCTGGGCTAGGAAGG + Intronic
1173120774 20:40287207-40287229 CTCCCAGACCTGGGCTCCTTGGG - Intergenic
1174081221 20:47971967-47971989 ATCACTGTCCTGGGCCCAGTTGG - Intergenic
1179939576 21:44628919-44628941 CTCCCTGTGCTGGGCTGGGTGGG + Intronic
1179990015 21:44943068-44943090 CTCACTGACCTTGGCAGGGAAGG - Intronic
1180065004 21:45407905-45407927 TTCAGTGACCTGGGTTCCGTGGG + Intronic
1181041240 22:20193669-20193691 CTCAGGGACCTGGCCTCGGGGGG + Intergenic
1181080064 22:20408001-20408023 TTCACTGACCAGGGCTGGGCAGG + Exonic
1181450551 22:23017270-23017292 CTCACTGCCCAGGGCCCGGGGGG + Intergenic
1181902334 22:26166984-26167006 CTGAGTGACCTTGGCTGGGTTGG + Intergenic
1182357756 22:29729970-29729992 CTCAGGGACCAGGGCTGGGTTGG - Exonic
1182480666 22:30606839-30606861 CTCCTTGTCCTGGGCTAGGTGGG + Exonic
1184509964 22:44927536-44927558 CTCACCGCCCTGGGGACGGTGGG + Intronic
1184551646 22:45207685-45207707 CTCACTGACTCGGGCTCCGAGGG + Intronic
950507811 3:13406588-13406610 CTGGCTGACCTGGCTTCGGTGGG - Intronic
953487847 3:43319098-43319120 CTCACTGAGATGGGCCAGGTGGG + Intronic
953694410 3:45146381-45146403 CTCACTCACCTGCGCGCGGGCGG + Exonic
954720264 3:52555562-52555584 CTGAGTGACCTGGACTTGGTTGG - Intronic
954793103 3:53147395-53147417 CGCACTGTCCTGGGCGCAGTGGG - Intergenic
955653597 3:61221109-61221131 CTCCCTGACCCTGGCTGGGTTGG + Intronic
962195082 3:133354703-133354725 CTCTCTGAGCTGGGCTTGCTGGG - Intronic
962323282 3:134408681-134408703 TTCTCTGACCTGGGCTCTGTAGG - Intergenic
966080025 3:175989388-175989410 CTCAGTGACCTGGGCACAGAAGG - Intergenic
981021139 4:140030225-140030247 GTCACTGACGTGTGATCGGTGGG - Intronic
986390019 5:7276585-7276607 CTCACTGCCCTGGACTAGGAGGG - Intergenic
992373136 5:76165918-76165940 CTCACTCTCCTGGTCTGGGTTGG - Intronic
998092467 5:139379346-139379368 CCCACTGACCTGTGCTCGGAGGG + Exonic
998230213 5:140357080-140357102 CTGAGTGCCCTGGGCTGGGTAGG - Intergenic
999238296 5:150113102-150113124 CCCACAGGCCTGGGCTCGGCAGG + Intronic
1002434561 5:179222681-179222703 CTCACTGAGATGGGCTGGGTGGG + Intronic
1007125378 6:39421841-39421863 GTCACTGTGCTGGGCTCTGTGGG + Intronic
1014215028 6:118745170-118745192 CCCTCTGCCCTGGGCTGGGTGGG - Intergenic
1018908965 6:168091014-168091036 CTCTCTGCCCTGGGCTCCGTGGG + Intergenic
1019391759 7:791779-791801 CTCACTGGCCTGGTGTCTGTGGG - Intergenic
1019430120 7:995189-995211 CTCACTGACCTGCACGGGGTAGG + Intergenic
1019629699 7:2041952-2041974 CTCTCTGGCCTTGGCTGGGTAGG - Intronic
1023177595 7:37448616-37448638 CTCGCTGACCTCGGCGCGGCAGG - Intronic
1023339551 7:39205402-39205424 CTCACTGACCTGGGCCTGTGGGG - Intronic
1032167685 7:129558510-129558532 CTCATTGACGTGGGCTTCGTGGG + Intergenic
1033303086 7:140203421-140203443 CTGACTGAGCTGGTCTCGGCAGG + Intergenic
1034260638 7:149753216-149753238 CCCACTGGCCTGGGCTTGGGGGG + Intergenic
1035727729 8:1835020-1835042 CGCTCTGAGCTCGGCTCGGTCGG + Intronic
1036004122 8:4642592-4642614 CTCTCAGTCCTGGGCTGGGTGGG + Intronic
1036754030 8:11460670-11460692 CACAATGACCTGGGCTAGGGAGG + Intronic
1040456396 8:47602559-47602581 CCACCTGACCTGGGCTGGGTGGG - Intronic
1044839215 8:96323594-96323616 CTCACTGACCAGGGCTACCTAGG - Intronic
1049073109 8:140372391-140372413 CTCACTGCCATGGCCTCGATGGG + Intronic
1051366972 9:16328238-16328260 CTCCCTGACCTGGGCTAGGATGG - Intergenic
1060551903 9:124489671-124489693 CTCAGGGACCCAGGCTCGGTTGG - Intronic
1061986306 9:134132146-134132168 CCCACTGACCTGGGCTGGCAGGG + Intergenic
1188444391 X:30241629-30241651 CTCTCTGTCCTGGGCTCTTTAGG - Intergenic
1196570153 X:117256678-117256700 CTCACTGCCCCGGGGTCAGTGGG - Intergenic
1197699975 X:129592001-129592023 ATCACTGACCTGGGATCTTTGGG + Exonic
1199853672 X:151742629-151742651 CTCACTGACCTGTGCGCAATCGG - Exonic
1200047769 X:153411690-153411712 CCCTCTTACCTGGGCTCGGCGGG - Intergenic