ID: 1088804459

View in Genome Browser
Species Human (GRCh38)
Location 11:113339411-113339433
Sequence TAGAACAAGGGGATCTGGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088804459 Original CRISPR TAGAACAAGGGGATCTGGTC AGG (reversed) Exonic
900310716 1:2032038-2032060 TGGAACACGGGGCTGTGGTCTGG - Intergenic
901523318 1:9802639-9802661 ATGAACAGTGGGATCTGGTCTGG - Intronic
905868049 1:41386905-41386927 TAGCATAGGGGGAGCTGGTCAGG - Intergenic
907363917 1:53944929-53944951 CAGAACCAAGGGAGCTGGTCAGG - Intronic
907544205 1:55245223-55245245 AAGAAAAAGTGGATCTGGCCAGG - Intergenic
911172163 1:94781498-94781520 AAGAAAAAGGGGATCTGGCTAGG + Intergenic
914682303 1:149947175-149947197 CAGAACAAGGAGATCTGGGATGG - Intronic
915371480 1:155354953-155354975 TATAACAAGGAGAACTGGACTGG + Intronic
915686689 1:157641189-157641211 TACAACAAGGGGAGCTGGGAGGG - Intergenic
915796416 1:158738921-158738943 TAGAATAAGATGATCTGGTATGG - Intergenic
916403810 1:164477088-164477110 AAGAACAGTGAGATCTGGTCGGG + Intergenic
919418534 1:197341549-197341571 AAGAAAAGGGTGATCTGGTCTGG + Intronic
919761613 1:201101700-201101722 ATGAACAGGGGGATCTGGGCAGG + Intronic
924082708 1:240416024-240416046 AAGAGGAAGGGGCTCTGGTCTGG - Intronic
1065400654 10:25296349-25296371 TAGAGAAGGGGGATCTGGTAGGG + Intronic
1069871382 10:71535286-71535308 TAGAACATGGAGACCTGATCAGG - Intronic
1073781515 10:106843729-106843751 TAGAAAAAGGAAATCTTGTCTGG - Intronic
1074259426 10:111836822-111836844 TAGAAAAAGGAGGTATGGTCTGG + Intergenic
1074890848 10:117735562-117735584 AAGTACAAGGGGAAGTGGTCAGG - Intergenic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1076591579 10:131587248-131587270 CAGACCATGGGGATGTGGTCAGG + Intergenic
1076684955 10:132194402-132194424 TAGAACAGTGGGAGCTGGGCTGG - Intronic
1080559258 11:33447254-33447276 TAAAGCAAGGGGGTCTGGTAGGG + Intergenic
1081868075 11:46370598-46370620 CAGCACATGGGGGTCTGGTCAGG + Intronic
1088804459 11:113339411-113339433 TAGAACAAGGGGATCTGGTCAGG - Exonic
1091764986 12:3113895-3113917 TGGAACAAGGGGACCTGCCCAGG - Intronic
1091802359 12:3332690-3332712 AAGATCAAGGTGATCTGTTCTGG + Intergenic
1092767513 12:11866593-11866615 TAGGACAAGGGGATCTGCTAAGG - Intronic
1097973668 12:65662109-65662131 TATAACAAGGTGACCTGATCAGG + Intergenic
1099550294 12:84035004-84035026 TAGAATGAGGGAATCTGGCCAGG + Intergenic
1102042791 12:109811286-109811308 GAGTAGAAGTGGATCTGGTCTGG + Intronic
1104392997 12:128407038-128407060 TAGAACATGGTGATATGGTTTGG + Intronic
1104445721 12:128831825-128831847 GATAATAAAGGGATCTGGTCGGG + Intergenic
1113618092 13:111695171-111695193 TAGAACAGAGTGATATGGTCGGG + Intergenic
1113623625 13:111780432-111780454 TAGAACAGAGTGATATGGTCGGG + Intergenic
1121228729 14:92340861-92340883 TAGAACAAATGCATCTGCTCTGG - Intronic
1122310718 14:100792384-100792406 TAGAAAAAGGGGACCGGCTCTGG - Intergenic
1131241421 15:90747045-90747067 TAGAAAAATGGGACCTGGCCTGG - Intronic
1132708027 16:1254871-1254893 GAGACCAAGGGGAGCTGGGCTGG + Intergenic
1136378281 16:29878027-29878049 GTGAACAAGGGGCTCTGGCCTGG - Intronic
1136635450 16:31519387-31519409 TAAAACATGGGGATCTGGCACGG + Intergenic
1137795966 16:51220282-51220304 TAGAACAAGGGGGTCTCAGCAGG + Intergenic
1141291688 16:82723553-82723575 TGGAAGAAGAGGATCTGGTGGGG + Intronic
1141439250 16:84018810-84018832 AAGACAAAGGGGATCTGGTCGGG + Intronic
1144016750 17:11203506-11203528 TAAAACAAGGTGATGTGGTGGGG + Intergenic
1145040127 17:19571612-19571634 TAGAAAAACAGGATCTGATCTGG + Intronic
1147112024 17:38270160-38270182 TAGAACAAGGGGCTCTAACCTGG - Intergenic
1147358915 17:39919059-39919081 AAGAAGAAGGGGTTCTGGCCGGG - Intronic
1148417550 17:47518641-47518663 TAGAACAAGGGGCTCTAACCTGG + Intergenic
1151463433 17:74269287-74269309 GAGAAAAAGGGGGTCGGGTCTGG + Intergenic
1153189191 18:2519070-2519092 TAGTCCAAGGGGATGTAGTCTGG - Intergenic
1154254155 18:12768204-12768226 TAGAACAAGGGGTGGTGGTCAGG - Intergenic
1155575287 18:27239024-27239046 TAGAACAAGAGTATCAGATCTGG + Intergenic
1156451282 18:37267737-37267759 TAGAAAAAGGGCACCTGGGCTGG + Intronic
1158383594 18:56963948-56963970 AAGAACAAGGTGACCTTGTCAGG + Intronic
1159960865 18:74555042-74555064 GAGAACAAGGGGAACTAGGCTGG - Intronic
1160389518 18:78519470-78519492 AAGAACAAGGGGTTCCGGGCTGG + Intergenic
1164436528 19:28235318-28235340 GAGACCAATGGGACCTGGTCAGG - Intergenic
1165741069 19:38205660-38205682 TGGAAGAAGGGGGTCTGCTCAGG + Intronic
932270043 2:70401269-70401291 GAGTACGAGGGGAGCTGGTCTGG + Intergenic
932572473 2:72945309-72945331 CAGAAGAAAGAGATCTGGTCTGG - Intronic
939373404 2:141331863-141331885 TAGAACAAGGGTAATTAGTCTGG - Intronic
940287976 2:152051062-152051084 TAGAAAAAGTGGATGTGGGCTGG - Intronic
941183759 2:162294553-162294575 TAAAACAAGGGGAACTTGTTAGG - Intronic
941548916 2:166889687-166889709 TCAAACAAGTGGATCTGGACAGG - Intronic
946224946 2:218259496-218259518 CAGAACCACGGGATCTGGTCGGG - Intronic
1174089494 20:48035742-48035764 TAGAACTGGGGAATCAGGTCTGG + Intergenic
1175458421 20:59132773-59132795 TGGAAGAAGGTGAGCTGGTCAGG + Intergenic
1178977708 21:37233782-37233804 GACAACAACGGGATCTGGCCTGG - Intronic
1182477793 22:30585683-30585705 TTGAAGAATGGGTTCTGGTCAGG + Intronic
949617621 3:5771408-5771430 TACAACAAGGAGAGATGGTCTGG - Intergenic
952286282 3:31972585-31972607 TAGAACTGGGGGCTCTGTTCTGG - Intronic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
955867771 3:63402990-63403012 GAGACCAAGGGGCTCTGGACAGG + Intronic
962378734 3:134879706-134879728 TAGAGCAAGGGAATCTAGTTTGG + Intronic
964025235 3:152065476-152065498 TGGAAGCAGGGGATCTAGTCAGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
970520590 4:16880049-16880071 AAGAAGAAGGGCATCTGGTTTGG - Intronic
971808361 4:31390888-31390910 TAGAACAAGGGCTTTTGGTCTGG - Intergenic
972047549 4:34686621-34686643 TAGAAGTAGGGGATCTTGACCGG + Intergenic
972458297 4:39275493-39275515 TGGAAGACGGGGATCTGGTCTGG - Intronic
973844045 4:54892786-54892808 TAAGACAAGGAGATGTGGTCAGG - Intergenic
975093147 4:70426440-70426462 TTAAACAAGGGGATCTTGTAAGG - Intergenic
977214742 4:94267793-94267815 AAGAACATGGGGATTTGCTCAGG - Intronic
979757110 4:124354658-124354680 TAGAACCAGGAGAGCTGGTACGG + Intergenic
981137907 4:141233981-141234003 GAGAACTAGGGGAGCTGCTCTGG + Exonic
982444313 4:155472119-155472141 AAGATCAAGGGGATGTGGTACGG + Intergenic
982956492 4:161774542-161774564 CAGATCAAGTCGATCTGGTCTGG - Intronic
984828531 4:183950408-183950430 CAGAAGAAGGGGACCTGGCCTGG + Intronic
986623959 5:9706300-9706322 CAGAACCAGGGGAACTGGCCTGG + Intronic
989139482 5:38189037-38189059 TAGCACAGGGGGGTCTGGGCTGG + Intergenic
990559908 5:56973541-56973563 TAGAACTAGGGGACCGGGGCAGG + Intergenic
991095771 5:62738266-62738288 GAGAAAAATGGGATCTGGCCAGG + Intergenic
991488536 5:67163160-67163182 TAGAACTAGGGGAGCTGCTCTGG - Exonic
991584834 5:68191251-68191273 TAGTACAAGGGGAGCTGCTTAGG - Intronic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
994013713 5:94939870-94939892 TACAACAAGAGGTTCTGATCTGG + Intronic
996577736 5:124994843-124994865 TAAAACAAGGTGCTGTGGTCTGG + Intergenic
999095265 5:148972527-148972549 TAGGACAAGGAGTTCTTGTCGGG - Intronic
1002360249 5:178664694-178664716 GAGAACATGGGGACCAGGTCTGG - Intergenic
1003245787 6:4380953-4380975 TACAACATGGGGATCTGGGCTGG + Intergenic
1003290104 6:4773157-4773179 TACAACAACGGGAGCAGGTCAGG + Intronic
1004469432 6:15916199-15916221 AAGATCAAGGGGATCAGGGCAGG - Intergenic
1007991772 6:46263355-46263377 TAGAAGAAGGGTATTTGGTAGGG - Intronic
1009817424 6:68753946-68753968 TAGGACATGGGGATCTGGAAAGG + Intronic
1016298160 6:142598713-142598735 GAGAACAATGGGATTTGATCTGG + Intergenic
1016779565 6:147943157-147943179 TAAAACATGGGTATCTGTTCTGG - Intergenic
1016785190 6:148003487-148003509 TAGAACAATGGTCTCTGGCCTGG - Intergenic
1019872347 7:3776479-3776501 CACAACAATGGGATCTGATCGGG - Intronic
1021234730 7:18128603-18128625 TAGAAGCAGGGGATCTGGAAAGG + Intronic
1026073106 7:67140255-67140277 AAGAACAAGGTGATATGGTTTGG - Intronic
1026534230 7:71226968-71226990 TGGAACAAAGGGAGCTGGGCAGG + Intronic
1026703779 7:72671959-72671981 AAGAACAAGGTGATATGGTTTGG + Intronic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1034898168 7:154890785-154890807 TAGTACAAGAGGATATGGGCAGG - Intronic
1038484662 8:27925627-27925649 TAGACAAATGGGATCTGCTCAGG + Intronic
1039452668 8:37688260-37688282 GAGAAAAAGGGGAGCTGTTCAGG - Intergenic
1040903654 8:52442357-52442379 TGGAACAAGTGGATCAGGCCAGG - Intronic
1041373535 8:57189874-57189896 TAGGACAAGGTGATCAGGGCTGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043517458 8:81007866-81007888 TATAACAGTGGAATCTGGTCCGG + Intronic
1043717107 8:83500446-83500468 TAGAACAAGAGAATCTTCTCGGG - Intergenic
1044753331 8:95436952-95436974 GAGAACAAGGGGATCTCATGGGG - Intergenic
1049651191 8:143770829-143770851 TAGAGCAAGGGGCTCAGGCCGGG + Intergenic
1050807423 9:9698568-9698590 TAGAACAAAGTTTTCTGGTCTGG + Intronic
1052915464 9:33921898-33921920 TAGAACAGGGGCTTCTGGTCTGG - Exonic
1053184525 9:36003935-36003957 TAGGACCAGTGCATCTGGTCTGG + Intergenic
1053255528 9:36614005-36614027 GAGAACCAGGGCATCTGGTCAGG + Intronic
1053893289 9:42717903-42717925 TAGAACAATCGGATCTTGTGAGG - Intergenic
1056116903 9:83449379-83449401 TAGAAGAAGGACATCTGGTCTGG + Intronic
1056884705 9:90430020-90430042 AGGGAAAAGGGGATCTGGTCAGG - Intergenic
1058375924 9:104321353-104321375 TAGAGAAAGGGGAAATGGTCAGG + Intergenic
1060203565 9:121667791-121667813 TAGAAAAAGTGGATCTGGCTGGG - Intronic
1185758828 X:2673780-2673802 TAGAACAACAGGAACTGATCGGG - Intergenic
1191802607 X:65098439-65098461 AAGAACAGGGGGATCTGGCAAGG + Intergenic
1191856807 X:65633971-65633993 GTGAAGAAGGGGATGTGGTCTGG - Intronic
1194159597 X:90434461-90434483 TAAAACAAGGTGATATGGTTTGG + Intergenic
1195879304 X:109575917-109575939 TTGAACAACTGGATCTGGTGAGG - Intergenic
1200137651 X:153882847-153882869 AAGAACACGGGGACCTGGGCTGG + Intronic
1200505898 Y:4011427-4011449 TAAAACAAGGTGATATGGTTTGG + Intergenic