ID: 1088809206

View in Genome Browser
Species Human (GRCh38)
Location 11:113378755-113378777
Sequence TTAGTGGCCTGACCCTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088809200_1088809206 0 Left 1088809200 11:113378732-113378754 CCAGGAGAATCTGCCTAGGGGTT 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1088809206 11:113378755-113378777 TTAGTGGCCTGACCCTGGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 171
1088809199_1088809206 1 Left 1088809199 11:113378731-113378753 CCCAGGAGAATCTGCCTAGGGGT 0: 1
1: 0
2: 0
3: 15
4: 107
Right 1088809206 11:113378755-113378777 TTAGTGGCCTGACCCTGGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088809206 Original CRISPR TTAGTGGCCTGACCCTGGGG AGG Intronic
900375077 1:2350554-2350576 TGGGAGGCCTGTCCCTGGGGTGG + Intronic
900988137 1:6085264-6085286 TCTGCGGCCTGTCCCTGGGGTGG + Intronic
902701978 1:18178766-18178788 TGGGAGGCCAGACCCTGGGGTGG - Intronic
906492545 1:46279469-46279491 GTGGGGGCCAGACCCTGGGGAGG - Intronic
909880686 1:80873700-80873722 TTAGTGGACTGCCCCTGCTGTGG - Intergenic
910832947 1:91478681-91478703 TTAGTGACCAGACCCTTTGGGGG + Intergenic
912716115 1:111984750-111984772 TTCATGGACAGACCCTGGGGAGG + Intronic
913083203 1:115409316-115409338 TTGGTGTTCTGGCCCTGGGGAGG + Intergenic
914588523 1:149084776-149084798 TGAATGGGCTGACACTGGGGGGG + Intronic
918103912 1:181400376-181400398 TATGTGGCCTGACGTTGGGGTGG + Intergenic
918431505 1:184465553-184465575 TTATCGGCCTGTTCCTGGGGTGG + Intronic
919701764 1:200638565-200638587 CTACTCGCCTGAGCCTGGGGAGG - Intronic
920430320 1:205914640-205914662 TTAGTGGGCTGTCCCCGGGGAGG + Exonic
921165945 1:212507282-212507304 ATAGAGGCCTGTCCCTTGGGTGG + Intergenic
1065772459 10:29090178-29090200 TTAGAGGCCGGACCTTTGGGAGG + Intergenic
1067469062 10:46523253-46523275 TCACTGGCTTGACCCTGGGTGGG + Intergenic
1070250456 10:74768572-74768594 ATGGTGGACTCACCCTGGGGTGG + Intergenic
1071020863 10:81053662-81053684 GTAGTGGCCTGAGGCTGCGGTGG + Intergenic
1075002383 10:118808339-118808361 TTACTGTCCTGTCCCTTGGGTGG - Intergenic
1075997864 10:126892969-126892991 TCAATGGCCTCAGCCTGGGGTGG + Intergenic
1077304450 11:1862842-1862864 TTAGTGAGCTCACCCAGGGGAGG - Intronic
1078157682 11:8812858-8812880 TCAGTGTCCTCATCCTGGGGAGG - Intronic
1084028941 11:66469598-66469620 TTAGTGGCCTTGCCTTGGGCTGG - Intronic
1087012383 11:93526214-93526236 CTGGTGGTCTGCCCCTGGGGAGG - Intronic
1087288367 11:96291883-96291905 TGAGTGGCTGGACTCTGGGGTGG + Intronic
1088566395 11:111177431-111177453 TGAGTGGCCTGAATCTGGTGAGG + Intergenic
1088582268 11:111327819-111327841 TTAGTTGTATGACCCTGGGTGGG - Intergenic
1088809206 11:113378755-113378777 TTAGTGGCCTGACCCTGGGGAGG + Intronic
1089493826 11:118898848-118898870 TTAGGGGGCTGAGCCTTGGGGGG + Exonic
1089500642 11:118929497-118929519 CCAGGGGCCGGACCCTGGGGAGG + Intronic
1090249793 11:125243329-125243351 TGGGTGGACTGTCCCTGGGGTGG + Intronic
1092771383 12:11900345-11900367 TGAGAGGCCTAGCCCTGGGGAGG - Intergenic
1094840862 12:34342191-34342213 GGAGTGGCCTGACCCCGCGGGGG + Intergenic
1096073243 12:48787671-48787693 TTAGGAGCCTGACTCTGGGGAGG - Intronic
1096504139 12:52082117-52082139 TTCCTGGCCTGAACCTGAGGGGG + Intergenic
1096677825 12:53234984-53235006 TCAGTGCCCTGATGCTGGGGGGG + Intergenic
1096858989 12:54509491-54509513 TTAGTAACCTGATCCTGGAGTGG + Intronic
1098131885 12:67359712-67359734 CTAGTGGATTGGCCCTGGGGTGG - Intergenic
1098486868 12:71031650-71031672 ATAGTAGCCTGACCTTGGGCTGG + Intergenic
1103037575 12:117668604-117668626 TTAATGGACTCACCCGGGGGTGG - Intronic
1103123681 12:118402391-118402413 TTCGTGGCCTGACTCTGGTAAGG + Intronic
1105067639 12:133214836-133214858 TAAGAGGGCTGACCCTGGTGAGG - Intergenic
1113957533 13:114107331-114107353 TTCGTGTCCTGACCCTCGCGGGG + Intronic
1114397590 14:22380864-22380886 TTTGTGGCTTGACCCTTTGGAGG - Intergenic
1114696086 14:24629120-24629142 TTAGTGGCAAGACCTTGGAGAGG + Intergenic
1117959527 14:61149069-61149091 TTAGTGGCCTGGCCTTTGGCTGG + Intergenic
1123420094 15:20124486-20124508 TTAGATGCCAGACCATGGGGAGG + Intergenic
1123445768 15:20329046-20329068 TTAGATGCCAGACCATGGGGAGG - Intergenic
1123529317 15:21131022-21131044 TTAGGTGCCAGACCATGGGGAGG + Intergenic
1128449893 15:67799408-67799430 GAAGTCACCTGACCCTGGGGTGG - Intronic
1128524867 15:68405486-68405508 TTAGTGTCATGGCCCTGGAGTGG + Intronic
1128749191 15:70136560-70136582 TTAGTGCCTGGACCCTGGTGGGG - Intergenic
1132830799 16:1927079-1927101 TTAGTGCCCAGGCCCTGGAGAGG + Intergenic
1133318982 16:4901371-4901393 TTACTGGCGTGACCCTGGGCAGG - Intronic
1134207153 16:12247637-12247659 GTAGTGGCATGACCCAGTGGAGG + Intronic
1136074544 16:27807780-27807802 TTAGTTGCATGACACTGGGTTGG - Intronic
1136720977 16:32319562-32319584 TTAGGTGCCAGACCATGGGGAGG + Intergenic
1136839362 16:33525848-33525870 TTAGGTGCCAGACCATGGGGAGG + Intergenic
1203005455 16_KI270728v1_random:198208-198230 TTAGGTGCCAGACCATGGGGAGG - Intergenic
1203137005 16_KI270728v1_random:1734329-1734351 TTAGGTGCCAGACCATGGGGAGG - Intergenic
1203149527 16_KI270728v1_random:1826133-1826155 TTAGGTGCCAGACCATGGGGAGG + Intergenic
1142985865 17:3695175-3695197 TCAGAGCCCTGACCCCGGGGTGG - Intronic
1143098196 17:4489710-4489732 TGAGTGTTCTGACCCTTGGGCGG - Intergenic
1146291823 17:31613187-31613209 TAGGTGGCCTGAGCCTGGTGTGG - Intergenic
1146824232 17:36009340-36009362 TTACTGGTCTGAACCAGGGGCGG + Intergenic
1147164138 17:38584490-38584512 AAAGTGGCCTGAGGCTGGGGTGG + Intronic
1152648813 17:81482521-81482543 TGAGTGGCCTGAGCCTGGGATGG + Intergenic
1153389095 18:4534275-4534297 TGAGTGTCCTGAAGCTGGGGTGG + Intergenic
1155439098 18:25842708-25842730 TCAGTGGCTTGGACCTGGGGTGG - Intergenic
1155529709 18:26754482-26754504 TTTGTCACCTGACCCTGGGAAGG + Intergenic
1161656558 19:5519357-5519379 TTAGTGCCCGGACCTTGGGGAGG - Intergenic
1161900091 19:7111949-7111971 TTAGTGGTTGGACCATGGGGAGG + Intergenic
1163026244 19:14514395-14514417 TAAGAGGCCAGACCCTGGGTTGG + Intergenic
1163270265 19:16248755-16248777 CCAGTGGCCTGCCCCTGGAGTGG + Intergenic
1163768575 19:19177208-19177230 CATGTGGCCTGAGCCTGGGGTGG + Exonic
1166542563 19:43615062-43615084 TTAGTTGCTGGACCATGGGGAGG + Intronic
1166769371 19:45271743-45271765 ATAGGGGCCTGACTGTGGGGAGG - Intronic
1167412973 19:49355894-49355916 CTAGTGCCCTGTCCCTGAGGAGG - Intronic
1167747559 19:51361387-51361409 TTAGTGATCTGTCACTGGGGTGG - Intronic
1168693269 19:58390281-58390303 AAAGTCGCATGACCCTGGGGAGG - Intronic
926892954 2:17653890-17653912 TTGGTTGCCTGAGCCTGGGGTGG - Intronic
927207265 2:20618463-20618485 TGACTGGCCTGGGCCTGGGGTGG - Exonic
927887181 2:26725720-26725742 TTACTGGCCCGACGCTGTGGAGG + Intronic
928450049 2:31370660-31370682 ATAGTGGCCTGAACATGGTGAGG - Intronic
932440287 2:71730654-71730676 TTAGTGGCAGGAGCCTGGTGGGG - Intergenic
934934793 2:98457274-98457296 TTAGTGGCATGCACCTGGTGAGG + Intronic
936016343 2:108961799-108961821 CTCGTGACCTGAGCCTGGGGAGG + Intronic
936148296 2:109996435-109996457 TTAGGTGCCAGACCATGGGGAGG + Intergenic
936196381 2:110374933-110374955 TTAGGTGCCAGACCATGGGGAGG - Intergenic
939146887 2:138426210-138426232 TTAGAGGCCTGCCCCTGGGAGGG - Intergenic
939435067 2:142165584-142165606 TTAGTAACCTGACACTGGAGAGG + Intergenic
941142172 2:161797953-161797975 ATAGTTACCTGACCCTGGGAAGG - Intronic
944778702 2:202995568-202995590 TTAATGGACTTACCCTGGGGAGG + Intronic
945704935 2:213218270-213218292 TGAGTGAGCTGAGCCTGGGGAGG - Intergenic
946192956 2:218017077-218017099 TCCGTGGTCTGAGCCTGGGGAGG - Intergenic
949070331 2:242020652-242020674 TTAGTGTCCTGCCACTGGAGAGG + Intergenic
1168915697 20:1484307-1484329 TTAGTTGCCTGACCCTTTTGAGG - Intronic
1171517703 20:25750848-25750870 TGAGAGGCCTGACCCAGGTGTGG + Intergenic
1172689506 20:36780555-36780577 TCAGTGCCCTGGCCCTGGGGTGG - Exonic
1172704353 20:36872138-36872160 TCAGTAGCCTGCCCCTGGGATGG - Intergenic
1174361993 20:50034739-50034761 CTCATGGCCAGACCCTGGGGAGG + Intergenic
1175875859 20:62228973-62228995 TTCGTGCCCAGACCCAGGGGAGG - Intergenic
1177109910 21:17013364-17013386 TTAGTGAGCTGACCTTGGGATGG + Intergenic
1179021797 21:37647600-37647622 TTTGAGGCCTAACTCTGGGGGGG - Intronic
1179176389 21:39010942-39010964 TTTGTGGCCCTGCCCTGGGGTGG + Intergenic
1180551793 22:16546748-16546770 TTAGGTGCCAGACCATGGGGAGG - Intergenic
1180600039 22:17009629-17009651 GTAGTGACCCGACCCTGAGGTGG + Intergenic
1180708479 22:17824057-17824079 TTAGGGGCCGGCTCCTGGGGAGG - Intronic
1180842570 22:18966131-18966153 TTGGTGGCCTCTCTCTGGGGAGG - Intergenic
1181058909 22:20272725-20272747 TTGGTGGCCTCTCTCTGGGGAGG + Intronic
1181352213 22:22267175-22267197 TTAGGTGCCAGACCATGGGGAGG + Intergenic
1185408549 22:50671373-50671395 GCAGTGGCCTCAGCCTGGGGTGG + Intergenic
950263916 3:11561128-11561150 TTATTGGGAGGACCCTGGGGGGG - Intronic
950656449 3:14439967-14439989 TTATTGATCTCACCCTGGGGAGG + Intronic
950668504 3:14511509-14511531 TTGGTGGCCTCAGCCTGGGGTGG + Intronic
950979173 3:17283558-17283580 TTATTGGCCTGACCATGTGACGG + Intronic
951966522 3:28391824-28391846 GTGGTGGCCTGGTCCTGGGGTGG - Intronic
952125044 3:30290630-30290652 TCCCTGGCCTCACCCTGGGGAGG - Intergenic
952502323 3:33975270-33975292 TTGATGACCTGACCCTGTGGAGG - Intergenic
953026510 3:39148248-39148270 TTTGTGGTTTGACCCTGGGAGGG - Intronic
953090515 3:39720993-39721015 TTAGTGACAGGACCCTGGAGTGG - Intergenic
954436804 3:50500564-50500586 GTGGTGGCCTGATGCTGGGGAGG + Intronic
954716230 3:52528298-52528320 TTAATGGAGGGACCCTGGGGAGG + Exonic
957188908 3:76980847-76980869 TTAGTTGCCTAAGGCTGGGGAGG - Intronic
959162172 3:102736524-102736546 TGCGTGGCCTGATCCTGAGGAGG + Intergenic
959666845 3:108932232-108932254 TTATTGGCCTGAGCCTGAGTGGG + Intronic
959689998 3:109188679-109188701 TAAGTGGGATGACTCTGGGGAGG - Intergenic
961166212 3:124765606-124765628 ATAGGGCCCTGTCCCTGGGGAGG - Intronic
961551479 3:127672665-127672687 TTTGAGGCCTGCCCCTCGGGCGG - Exonic
968092460 3:195907774-195907796 TCTGTGGCCCCACCCTGGGGAGG - Intronic
970483217 4:16498693-16498715 TTAGTGCCTTGAACCTGGGCTGG + Intergenic
977365626 4:96064412-96064434 TTAGGAGCCAGGCCCTGGGGTGG + Intergenic
983459074 4:168004371-168004393 TTAGTGGACTGACCCTATGTAGG - Intergenic
985105195 4:186492784-186492806 TTAGTGGCCTGACTCTGAGGAGG + Intronic
985708569 5:1415351-1415373 TGTGTGGCCTGTCACTGGGGTGG + Intronic
988816584 5:34840222-34840244 TTAGTGAAATGACCCCGGGGGGG + Intronic
990194132 5:53294023-53294045 TTACTGGGGTGACCATGGGGTGG + Intergenic
991717200 5:69462047-69462069 TCAGTGGGCTGCCCCTTGGGAGG + Intergenic
996014447 5:118517288-118517310 TTAGTGCCCTCACTCTGGTGAGG - Intergenic
996046810 5:118882970-118882992 TTTGCGGCCTGACCATGAGGTGG - Intronic
996294108 5:121890924-121890946 GAAGTGGCCTGACTTTGGGGAGG - Intergenic
996310959 5:122104704-122104726 TTAGTTGCCTGATCATGGAGAGG - Intergenic
998400781 5:141848006-141848028 CTAGTGGCATGACCTTGGGTAGG - Intergenic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1001226325 5:169947497-169947519 TTAGTTGCGTGGCCCTGGGCAGG - Intronic
1002282243 5:178138099-178138121 ATGGTGGCCTCAGCCTGGGGAGG - Exonic
1002488923 5:179559974-179559996 TTAGTGGACTGAGCGTGGGGAGG - Intronic
1005841069 6:29744901-29744923 ATAGAAGCCTGAACCTGGGGTGG - Intergenic
1006029615 6:31169880-31169902 TGAGTGACCAGACCCTGGGCAGG + Intronic
1006373916 6:33661409-33661431 TTAGTTGCATGACCCTCGGCAGG + Intronic
1007397051 6:41583865-41583887 ATAGAGGCCTGACCCAGGGCAGG + Intronic
1019491054 7:1313832-1313854 GGAGGGGCCTGACCCTGGGCTGG + Intergenic
1022527849 7:31049855-31049877 AGAGGGGCCTGTCCCTGGGGAGG + Intergenic
1023725516 7:43139166-43139188 ATACTGACCTGACCCTAGGGGGG + Intronic
1025258831 7:57403867-57403889 TGAGAGGCCTGACCCAGGTGTGG + Intergenic
1025942893 7:66086800-66086822 TCAATGTCCTGCCCCTGGGGAGG + Exonic
1026286873 7:68971043-68971065 TTGGTGGCATGCACCTGGGGAGG + Intergenic
1026903739 7:74051127-74051149 CTAGTGGTCTGACCCTGAGGTGG - Intronic
1026988436 7:74569429-74569451 TCTGCGGCCTGAGCCTGGGGTGG + Intronic
1028508655 7:91597414-91597436 TTAGTGCCCTGTCACTGGGCAGG + Intergenic
1032773848 7:135090034-135090056 GCACTGGCCTGACTCTGGGGAGG + Intronic
1034669265 7:152845678-152845700 TTAGGGGCCTGCTCGTGGGGTGG + Intronic
1038641734 8:29334294-29334316 CTATTGGACTGACGCTGGGGTGG + Exonic
1044513582 8:93112449-93112471 TAACTGGCCTGATCCTAGGGTGG - Intergenic
1045060106 8:98403606-98403628 TTTGAGGGCTGCCCCTGGGGAGG + Intronic
1047192339 8:122689528-122689550 TTAATTGTCTGACCCAGGGGAGG + Intergenic
1053135250 9:35646817-35646839 TCAGGGACCAGACCCTGGGGTGG + Intergenic
1053523388 9:38804755-38804777 TTGGCTGCCTGGCCCTGGGGTGG + Intergenic
1054195617 9:62029174-62029196 TTGGCTGCCTGGCCCTGGGGTGG + Intergenic
1054642790 9:67559515-67559537 TTGGCTGCCTGGCCCTGGGGTGG - Intergenic
1056224519 9:84482240-84482262 CCAGATGCCTGACCCTGGGGAGG + Intergenic
1056308977 9:85320896-85320918 ATGGTGGCCTGTCCCTGGTGGGG - Intergenic
1056657875 9:88523873-88523895 TTAAAGGCCAGCCCCTGGGGTGG - Intergenic
1058927181 9:109678020-109678042 TTAGTGGCCTGAGCAAGGAGGGG + Intronic
1060113432 9:120922925-120922947 AGAGTCGCCTGAGCCTGGGGAGG - Intronic
1060756523 9:126218297-126218319 CTCATGGCCTCACCCTGGGGAGG - Intergenic
1061705252 9:132448239-132448261 TTGGTTGCATGACCCTGGGAAGG + Intronic
1061949845 9:133930151-133930173 TAAAAGGCCTGACCCTGGAGGGG - Intronic
1187809199 X:23157003-23157025 TCAGAGGCCTGACACTCGGGAGG - Intergenic
1188014778 X:25096652-25096674 TTAGGGGCCAGGCCCTTGGGTGG + Intergenic
1188524122 X:31071350-31071372 CTAGTGGCCTGACCCAGGGAAGG + Exonic
1189030197 X:37442104-37442126 CTGGTGGCCTGACCCAGGGAAGG - Intronic
1189297852 X:39931265-39931287 CTAGTGGCCTGGCTTTGGGGTGG - Intergenic
1194587009 X:95747639-95747661 TTAATGATCTGACCCTGGGTAGG + Intergenic
1198118925 X:133571696-133571718 TCAGTGGCCTGAGCTTGGGAGGG + Intronic
1199369850 X:147034967-147034989 TTTCTGGGCTGACCCTGAGGAGG + Intergenic