ID: 1088809870

View in Genome Browser
Species Human (GRCh38)
Location 11:113385048-113385070
Sequence TTGTTTGGGCAGATTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088809870_1088809875 5 Left 1088809870 11:113385048-113385070 CCATCTTCAATCTGCCCAAACAA No data
Right 1088809875 11:113385076-113385098 ACTGATAGAGGTTAGTTGGAAGG No data
1088809870_1088809876 21 Left 1088809870 11:113385048-113385070 CCATCTTCAATCTGCCCAAACAA No data
Right 1088809876 11:113385092-113385114 TGGAAGGACTCAGAGCATTTTGG No data
1088809870_1088809877 22 Left 1088809870 11:113385048-113385070 CCATCTTCAATCTGCCCAAACAA No data
Right 1088809877 11:113385093-113385115 GGAAGGACTCAGAGCATTTTGGG No data
1088809870_1088809873 -7 Left 1088809870 11:113385048-113385070 CCATCTTCAATCTGCCCAAACAA No data
Right 1088809873 11:113385064-113385086 CAAACAAAATGCACTGATAGAGG No data
1088809870_1088809874 1 Left 1088809870 11:113385048-113385070 CCATCTTCAATCTGCCCAAACAA No data
Right 1088809874 11:113385072-113385094 ATGCACTGATAGAGGTTAGTTGG No data
1088809870_1088809878 23 Left 1088809870 11:113385048-113385070 CCATCTTCAATCTGCCCAAACAA No data
Right 1088809878 11:113385094-113385116 GAAGGACTCAGAGCATTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088809870 Original CRISPR TTGTTTGGGCAGATTGAAGA TGG (reversed) Intergenic
No off target data available for this crispr