ID: 1088812298

View in Genome Browser
Species Human (GRCh38)
Location 11:113399958-113399980
Sequence TGCTCCTCTGGACCGCCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088812298 Original CRISPR TGCTCCTCTGGACCGCCAGG TGG (reversed) Exonic
900098010 1:948220-948242 TGCTCTTCAGGACGGCCTGGTGG - Exonic
900462892 1:2809864-2809886 TGCTGCTCTGGACTCCCAGGAGG - Intergenic
901838329 1:11938398-11938420 TGCACCTCTGGACGGGAAGGGGG + Intronic
902183799 1:14710316-14710338 TTCTCCTCTGGCCAGCCAGAGGG + Intronic
902726403 1:18339004-18339026 GGCTCCTCTGGAATGCCAAGGGG + Intronic
904594566 1:31635311-31635333 TTCCCCTCTGGAACTCCAGGAGG - Exonic
905741426 1:40374234-40374256 TGGACCCCTGGCCCGCCAGGTGG - Intronic
907487913 1:54789789-54789811 TCCTCCTCTGGATAGCCATGGGG - Intronic
914673339 1:149888579-149888601 TCCTCCTCTTGACCTCCAGGAGG + Intronic
917107974 1:171514100-171514122 TGATCCTGTTGACTGCCAGGTGG + Intronic
920238919 1:204529458-204529480 TTCCCCTCTGGAACTCCAGGAGG - Intronic
923790025 1:237104084-237104106 TTCTCCTCTGGACCAGCAAGGGG + Intronic
1075859415 10:125661794-125661816 TGCTCCTGTGGACCTCCCAGGGG - Intronic
1076902868 10:133348267-133348289 TTCTCCTCAGGACCCCCAGCTGG - Intronic
1080060956 11:27956205-27956227 TGCTCCTTTGGACCTGCAGGTGG + Intergenic
1082963032 11:58937294-58937316 TGCTCCTTTGGACCTTCAGGAGG + Intronic
1083227867 11:61295712-61295734 GGCTCCTCTGGGCACCCAGGGGG + Intergenic
1083622292 11:64055203-64055225 TGCTCCTCTGGGCCGGGAGCAGG + Intronic
1084421227 11:69061655-69061677 TGCTCATGGGGACCCCCAGGTGG + Intronic
1087828631 11:102794620-102794642 TTCTTCTCTGGGCCTCCAGGGGG + Intronic
1088812298 11:113399958-113399980 TGCTCCTCTGGACCGCCAGGTGG - Exonic
1091280024 11:134376429-134376451 TCCCCATCTGGACCCCCAGGCGG - Intronic
1091732360 12:2890666-2890688 TGGTCCTCTGGAGCGCCTCGCGG - Intronic
1092173640 12:6388683-6388705 TGTTCCTCTGGGCCCCCGGGTGG + Intronic
1096738683 12:53676238-53676260 TTCTCCTCTCGAACGCCAGGTGG - Exonic
1097868328 12:64578544-64578566 TGCTCCTCTGGACACTGAGGTGG + Intergenic
1101719934 12:107342371-107342393 AGCTACTCTGGACAGCCAGAGGG - Intronic
1101739150 12:107486701-107486723 TCCTCCTCGGGACCTCCAAGGGG + Intronic
1104280277 12:127370572-127370594 TTCTTCCCTGGACCTCCAGGAGG - Intergenic
1105296494 13:19091244-19091266 TCCTCCTCTGGACACCCTGGGGG - Intergenic
1113610333 13:111640217-111640239 TGCTCCTCTGCACTGCCATTTGG - Intronic
1114081106 14:19201863-19201885 TGCTGCTCTGCTCCTCCAGGAGG - Intergenic
1115367608 14:32576264-32576286 TGCTCCTTATGACCTCCAGGTGG + Intronic
1118614028 14:67562906-67562928 TGCTCCTCTGCCCAGCCCGGAGG - Intronic
1123132918 14:106001436-106001458 TGCTGCTCAGAACCACCAGGGGG - Intergenic
1123147054 14:106142188-106142210 TGCTTCTCAGAACCACCAGGGGG - Intergenic
1123168512 14:106349188-106349210 TGCTGCTCAGGACCAGCAGGGGG - Intergenic
1123175848 14:106417920-106417942 TGCTGCTCAGAACCACCAGGGGG - Intergenic
1123187188 14:106531034-106531056 TGCTTCTCAGAACCACCAGGGGG - Intergenic
1123194769 14:106606021-106606043 TGCTGCTCAGGACCAACAGGGGG - Intergenic
1123198397 14:106639024-106639046 TGCTGCTCAGGACCAGCAGGTGG - Intergenic
1123582945 15:21731882-21731904 TGCTGCTCAGAACCACCAGGGGG - Intergenic
1123584156 15:21742269-21742291 TGCTGCTCAGGACCAGCAGGGGG - Intergenic
1123619595 15:22174478-22174500 TGCTGCTCAGAACCACCAGGGGG - Intergenic
1123620806 15:22184872-22184894 TGCTGCTCAGGACCAGCAGGGGG - Intergenic
1125730071 15:41888082-41888104 TGCTGCCCTGTCCCGCCAGGAGG - Exonic
1128564017 15:68687469-68687491 TGCTCCCCTGGACAGCCTGCTGG + Intronic
1129145052 15:73639503-73639525 TCCTTCTCTAGACCTCCAGGAGG + Intergenic
1130270855 15:82446073-82446095 TGCTCCCCTGGACCGCGACGGGG + Intergenic
1130463195 15:84173396-84173418 TGCTCCCCTGGACCGCGACGGGG + Intronic
1130489479 15:84421392-84421414 TGCTCCCCTGGACCGCGACGGGG - Intergenic
1130501070 15:84500154-84500176 TGCTCCCCTGGACCGCGACGGGG - Intergenic
1130508581 15:84570244-84570266 TGCTCCCCGGGACCGCGACGGGG - Intergenic
1132198492 15:99931891-99931913 TGCCCCTGTGGACCCCCAGATGG + Intergenic
1136073432 16:27802609-27802631 GGCTCCCCTGAACCCCCAGGAGG + Intronic
1136691893 16:32038911-32038933 TGCTTCTCAGAACCACCAGGGGG + Intergenic
1136792481 16:32982473-32982495 TGCTTCTCAGAACCACCAGGGGG + Intergenic
1136877336 16:33871434-33871456 TGCTTCTCAGAACCACCAGGGGG - Intergenic
1139511342 16:67430232-67430254 TGCTCCCCTGAACCCCCAGGGGG - Intergenic
1203094687 16_KI270728v1_random:1243938-1243960 TGCTTCTCAGAACCACCAGGGGG + Intergenic
1143111535 17:4555585-4555607 TGCCCCTTTGGAGCCCCAGGGGG + Intronic
1143275539 17:5707032-5707054 TTCCCCACAGGACCGCCAGGAGG - Intergenic
1143511049 17:7395087-7395109 TCCTCCTCTGGCCCTCTAGGCGG - Exonic
1146725059 17:35149714-35149736 TCCTCCTCAAGACAGCCAGGCGG - Intronic
1146915096 17:36673272-36673294 TCATCCTCTTGGCCGCCAGGAGG - Intergenic
1147739870 17:42665457-42665479 TGCTCTTCTGTCCCCCCAGGTGG + Exonic
1148674134 17:49435237-49435259 TGCTCCTTTTGTCCGCTAGGAGG + Intronic
1148850223 17:50550988-50551010 TTCTCCTCAGGACCCCAAGGGGG + Exonic
1148865523 17:50626305-50626327 GGCTCCTCCTGGCCGCCAGGGGG - Exonic
1149536970 17:57440776-57440798 TGGTCCTCTGGTCCGCCAAGAGG + Intronic
1151350259 17:73527671-73527693 CGCTCCTCTGCACTGCCAGGAGG - Intronic
1151558705 17:74859933-74859955 TGCTCAGCTTGGCCGCCAGGAGG - Intronic
1157326707 18:46674386-46674408 AGCTCCCCTGGACAGGCAGGAGG + Intronic
1161042415 19:2117120-2117142 TGCACCCCTGAACAGCCAGGAGG - Intronic
1163832674 19:19554547-19554569 TTCTCTACTGGGCCGCCAGGGGG - Intergenic
1164854491 19:31510565-31510587 TGCTCCTCTGGACTCCCGGGTGG + Intergenic
1165827385 19:38713029-38713051 TGCTCCTCAGGACAGCCCCGTGG + Intronic
1165845567 19:38815913-38815935 TGGTGCTCTGCACCGCCACGGGG + Exonic
1166122569 19:40694229-40694251 TGCTCCCATGGACTGCCAGCTGG + Intronic
1168267410 19:55230387-55230409 CTCTCCTCTGGACCCCCAGGAGG - Exonic
1168707908 19:58480193-58480215 TGGGCCTCTGGGCAGCCAGGTGG - Exonic
929299939 2:40291636-40291658 TACTTCTCTGGACTGGCAGGTGG - Intronic
932127230 2:69155267-69155289 TGTTCCTCAGTATCGCCAGGTGG + Intronic
933664202 2:84951411-84951433 TGCTTCTCTTGACTGTCAGGTGG - Intergenic
935349906 2:102143734-102143756 TTCTCCTCTGCACTGCCGGGAGG + Intronic
940752102 2:157637694-157637716 TGCACCTCTGGAACCTCAGGTGG - Intergenic
948328677 2:237148247-237148269 TGCTCCTTGGGACCACCAGCGGG - Intergenic
948560087 2:238846772-238846794 TGCTCCTCCGGCCGGCCAGGCGG - Intergenic
948693941 2:239723308-239723330 TGCTTCTCTGGGCCCCCAGTGGG - Intergenic
948747184 2:240105520-240105542 TGCTCCTCTGGGCCCCCTGAGGG + Intergenic
1171395096 20:24827766-24827788 TGCTCCTCTGGCCCCACAGAGGG - Intergenic
1173611618 20:44372427-44372449 GGATCCTCTGGACAGACAGGTGG - Intronic
1174993178 20:55535878-55535900 TGCTCGTCTGGAAAGCCACGAGG - Intergenic
1175136766 20:56830064-56830086 TCCTCCTCTGGAGCGAAAGGAGG - Intergenic
1175545133 20:59773166-59773188 CGCTCCCCTGCACCTCCAGGAGG - Intronic
1175858195 20:62133929-62133951 AGCGCCTCGGGACAGCCAGGTGG + Intronic
1178502342 21:33136134-33136156 TGCTCCACTGAACCTCCAGCTGG + Intergenic
1179714222 21:43279618-43279640 TGCTGCACTGGACCGCCCGAGGG + Intergenic
1180499667 22:15920823-15920845 TGCTGCTCTGCTCCTCCAGGAGG + Intergenic
1181926358 22:26362261-26362283 TCCTGCTCTGGAATGCCAGGGGG + Intronic
1183082504 22:35465481-35465503 TGCTACTCAGGACCGCAGGGAGG - Intergenic
1183326990 22:37199624-37199646 TGCTCCCCAGGCCCGGCAGGGGG - Intergenic
1183387856 22:37525374-37525396 TGCCCCTCTGCACCACAAGGTGG + Intergenic
1183541823 22:38433834-38433856 GCCTCCTCTGGACCCCCAGGAGG - Intronic
1183633267 22:39046093-39046115 TGCTCCTCTTGGCTGGCAGGGGG + Intronic
952498760 3:33939229-33939251 TGCTCCTCAGGGCAGCCAGTAGG + Intergenic
954807317 3:53228134-53228156 TGCTCTTCAGGACCACCTGGGGG + Exonic
955981324 3:64530361-64530383 TGCTTCTCTGGACCACACGGGGG + Intronic
962271088 3:133978634-133978656 TGCTCCTCTGGAGCATCATGAGG - Intronic
962301291 3:134245489-134245511 TGCCCCTCAGGACCTCCAAGAGG + Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
981532074 4:145762691-145762713 GGCCCCTCTGGACAGCCAGGAGG - Intronic
985826185 5:2193262-2193284 TCCTCCTCAGCACTGCCAGGAGG - Intergenic
990954796 5:61331534-61331556 AGCTCCCCTGGACCGGCTGGAGG + Intergenic
999746410 5:154595771-154595793 TGCTCCTCCTGACCGCTAGCCGG - Intergenic
1002277634 5:178113995-178114017 TGCTCCGCTGGAGGGGCAGGCGG + Intronic
1006730989 6:36235990-36236012 TGCTTCTCTGGACTTCCAGCCGG - Intergenic
1007739735 6:44003176-44003198 TGGTCCTGGGGACCGCGAGGTGG - Exonic
1015935667 6:138404312-138404334 TCTGCCTCTGGACCGCGAGGGGG - Exonic
1017042379 6:150317772-150317794 TAGTACTCTGGAGCGCCAGGTGG - Intergenic
1017934728 6:158995420-158995442 TTCTCCCCAGGACCTCCAGGAGG - Intronic
1019660189 7:2219782-2219804 TGCTGCTCTGGAGCACCAGGAGG - Intronic
1026827494 7:73593686-73593708 TGCTCTTCTTGACCTCCAGGAGG + Exonic
1029189604 7:98762241-98762263 TCCTCCTCTGTACAGCAAGGAGG + Intergenic
1037751447 8:21684910-21684932 TGCACCTCTGGACCGCATGCAGG + Intergenic
1038343186 8:26706778-26706800 TGCTCCTCTGGATAGCAAAGTGG - Intergenic
1040980510 8:53241943-53241965 TGCGCCTCTGGACCCCTAGAAGG + Intronic
1045317752 8:101058041-101058063 GGCTCCTGTGGACCCCCTGGGGG + Intergenic
1049248086 8:141573333-141573355 TGGTCCTCAGGGCCCCCAGGAGG + Intergenic
1056009652 9:82313782-82313804 TGCTCCTCTGAACAGCCACTGGG - Intergenic
1057908081 9:98997735-98997757 TGCTCCTCTGCACAGGTAGGGGG - Intronic
1060220746 9:121762892-121762914 TGCTACCCTGGATTGCCAGGTGG + Intronic
1060408686 9:123385559-123385581 TCCTACCCTTGACCGCCAGGTGG - Intronic
1061289248 9:129641581-129641603 TGCTCCTCTGCCACGCCGGGGGG + Intronic
1061401127 9:130369031-130369053 TTCTCCTCTGGACCACTGGGGGG - Intronic
1186991072 X:15068681-15068703 TGCACCTCTGGAGCCTCAGGTGG - Intergenic
1202371998 Y:24205216-24205238 TGCTCCCCTGGACCGCGACGGGG - Intergenic
1202498787 Y:25464900-25464922 TGCTCCCCTGGACCGCGACGGGG + Intergenic