ID: 1088812344

View in Genome Browser
Species Human (GRCh38)
Location 11:113400183-113400205
Sequence GGGCATCATGTCCTTCCTAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088812341_1088812344 -5 Left 1088812341 11:113400165-113400187 CCTCCGCAGCCGAAAGCAGGGCA 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1088812344 11:113400183-113400205 GGGCATCATGTCCTTCCTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 102
1088812337_1088812344 7 Left 1088812337 11:113400153-113400175 CCTGCAACTGGCCCTCCGCAGCC 0: 1
1: 0
2: 1
3: 11
4: 231
Right 1088812344 11:113400183-113400205 GGGCATCATGTCCTTCCTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 102
1088812335_1088812344 9 Left 1088812335 11:113400151-113400173 CCCCTGCAACTGGCCCTCCGCAG 0: 1
1: 0
2: 0
3: 38
4: 379
Right 1088812344 11:113400183-113400205 GGGCATCATGTCCTTCCTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 102
1088812342_1088812344 -8 Left 1088812342 11:113400168-113400190 CCGCAGCCGAAAGCAGGGCATCA 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1088812344 11:113400183-113400205 GGGCATCATGTCCTTCCTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 102
1088812340_1088812344 -4 Left 1088812340 11:113400164-113400186 CCCTCCGCAGCCGAAAGCAGGGC 0: 1
1: 0
2: 0
3: 15
4: 99
Right 1088812344 11:113400183-113400205 GGGCATCATGTCCTTCCTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 102
1088812336_1088812344 8 Left 1088812336 11:113400152-113400174 CCCTGCAACTGGCCCTCCGCAGC 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1088812344 11:113400183-113400205 GGGCATCATGTCCTTCCTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088812344 Original CRISPR GGGCATCATGTCCTTCCTAG AGG Exonic
901241281 1:7695182-7695204 GGGCATCAGGTCCCACCTCGTGG - Intronic
908748187 1:67395713-67395735 GTGCATCATGTCTTTCTCAGAGG - Exonic
912010790 1:104959047-104959069 AGGCATCAGCTCCTTTCTAGTGG + Intergenic
915297091 1:154929102-154929124 GCGGATCATGTCCTTCCGAAAGG + Exonic
919904264 1:202067247-202067269 GGGCAGCGAGTCCTTCCTTGAGG - Intergenic
923692992 1:236214546-236214568 TGGCATATTGTCCTTCATAGGGG - Intronic
923838401 1:237640605-237640627 TGGCTTCTTTTCCTTCCTAGTGG - Intronic
923949719 1:238935576-238935598 GGGCATCATGTGGTACCTTGTGG - Intergenic
924946543 1:248850556-248850578 GGCCATCATGACTTCCCTAGGGG + Intronic
1070545264 10:77447026-77447048 GGGCCTCAAGTCCTTCTTCGAGG - Intronic
1074225825 10:111483478-111483500 GGGCATCAGGCCCTTCCTTGGGG - Intergenic
1074345020 10:112676608-112676630 GGGCAGTATGTCCCTACTAGTGG + Intronic
1074911265 10:117911516-117911538 GCACCTCATCTCCTTCCTAGAGG + Intergenic
1083999397 11:66288087-66288109 GTGCACCATGTCCTTCCCATGGG + Exonic
1088082111 11:105931126-105931148 TGGCAACATGGCATTCCTAGTGG + Intronic
1088812344 11:113400183-113400205 GGGCATCATGTCCTTCCTAGAGG + Exonic
1089296002 11:117468677-117468699 GGGCAGCTGGTCCTTCCTGGGGG - Intronic
1090273236 11:125402353-125402375 GGTTCTCCTGTCCTTCCTAGAGG + Intronic
1093627711 12:21369833-21369855 GGGCATAATCTCCTTTCTAAAGG - Intronic
1098136736 12:67410860-67410882 GAGCATAATTTCCTCCCTAGTGG - Intergenic
1099434121 12:82623363-82623385 GGGCAGCAAGTTCTTCCTTGGGG - Intergenic
1100968736 12:100043694-100043716 GGGAATCATTCCCTTCCTGGGGG + Intronic
1101469261 12:104981341-104981363 GGGCATCATCTCATTCATAAGGG - Intergenic
1101717322 12:107321786-107321808 GGGCTTAATTTCCTTCCTGGTGG + Intronic
1106095228 13:26637531-26637553 GGGCAACAGGGCCTTCCTAGTGG - Intronic
1106831820 13:33592471-33592493 GGGCCTCATGCCCTTGCCAGGGG + Intergenic
1107969491 13:45627592-45627614 GTGCATCATGTCCTGCTTAGTGG + Intergenic
1113237080 13:108289334-108289356 GGGCAACCTGTCCATCCTAAAGG - Intronic
1113428283 13:110228192-110228214 GGGCATCCTGTGCTTGATAGCGG - Intronic
1114531433 14:23399010-23399032 GGGCATCATGTCCATCCTGGAGG - Exonic
1116047988 14:39767510-39767532 AGGCTTCATGTCCTTCAAAGAGG + Intergenic
1122714760 14:103689117-103689139 GGGCATCATGTAATTCCTGGAGG - Intergenic
1123583677 15:21738413-21738435 AGGCATCATGGCTTTTCTAGAGG - Intergenic
1123620327 15:22181016-22181038 AGGCATCATGGCTTTTCTAGAGG - Intergenic
1128061327 15:64737598-64737620 GGGCATCAGGGGCTTCCCAGTGG + Intergenic
1128343834 15:66841580-66841602 TGGCATCCTGTCCTTCACAGTGG + Intergenic
1128601137 15:68996375-68996397 TGGCATGATTTTCTTCCTAGAGG - Intronic
1130087123 15:80787113-80787135 GGGCATCATTTTCTCCCTTGAGG - Intronic
1135508658 16:23061661-23061683 AGGCAGGATGTCTTTCCTAGAGG - Exonic
1140306540 16:73808019-73808041 GGGTATAATGTCCATGCTAGAGG + Intergenic
1140896053 16:79325167-79325189 GGGCAACATGTCTTTTCTTGGGG + Intergenic
1141306783 16:82872051-82872073 CAGCATCATTTCCTTCCTTGAGG - Intronic
1143244623 17:5473238-5473260 TGGAATCATCTCTTTCCTAGGGG + Exonic
1146983709 17:37191494-37191516 GTGCATCATTCCCTTCCAAGAGG + Intronic
1147355570 17:39893463-39893485 GGGAAACATTTCCTTCTTAGGGG - Intergenic
1149375592 17:56040842-56040864 GGACAGCATGTCCTTCCCAATGG + Intergenic
1150632589 17:66890429-66890451 GGGCCTCATGTCCTTGGTACTGG + Intergenic
1151458914 17:74243252-74243274 GGGCAGCATGTCCATAGTAGAGG + Intronic
1152456885 17:80421878-80421900 GGGCTTCCTGGCCTTCCGAGAGG + Exonic
1155795990 18:30036914-30036936 GGGCATCAAGTCATTCATAAGGG + Intergenic
1159985564 18:74836790-74836812 TGTCATCATGTGCTTCCTAGAGG + Intronic
1160439934 18:78881893-78881915 GGGCATCTCGTCCTTCAAAGAGG + Intergenic
1161994805 19:7705661-7705683 CCCCATCATGTCCTTCCCAGGGG + Intergenic
1162437191 19:10668306-10668328 GGGCATCATTTGACTCCTAGGGG + Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1165729471 19:38135471-38135493 GGGGTGCATGTCCTTCCTCGAGG - Intronic
1168642850 19:58041306-58041328 GGCCAGCAGGTCCCTCCTAGAGG + Intronic
925882805 2:8367190-8367212 GGGCATCCTATCCTTTCTAGGGG - Intergenic
933633107 2:84678626-84678648 GGGGACCATGTCTTTCCCAGTGG - Intronic
935208073 2:100913937-100913959 GGGGATCAGGTCCTTCTGAGAGG - Intronic
937977709 2:127591811-127591833 TGGCATGATGTCCTTCCCTGGGG - Intronic
938029910 2:127983118-127983140 AGACATCATGTCCTTCCAAAAGG + Intronic
942085844 2:172443067-172443089 GGGCATCCTATTCTTCCTGGAGG + Intronic
944491917 2:200266714-200266736 GGTCACCATGTCCTTCTCAGTGG + Intergenic
945684817 2:212956541-212956563 CAGCATCATGTACTTCCTGGAGG - Intergenic
947533634 2:230927857-230927879 GGGCATCCTTTCCCTCCAAGGGG + Intronic
947544769 2:231002952-231002974 GAGCATCAGGTCTTCCCTAGAGG - Intronic
948204487 2:236156096-236156118 GGGCATGAGGGCCTTCCTGGGGG - Intergenic
1172445195 20:34989745-34989767 GGGCATCCTGTCCATCCTGGAGG + Exonic
1174506566 20:51021386-51021408 GGGCATGCTGTCCTTCTTTGGGG - Intronic
1174664417 20:52244698-52244720 GAGAATCATTTGCTTCCTAGAGG - Intergenic
1175195875 20:57243035-57243057 GTGGCTCATGGCCTTCCTAGTGG + Intronic
1176043706 20:63081605-63081627 GGGCAGGAAGGCCTTCCTAGAGG + Intergenic
1176077024 20:63253340-63253362 AGGCATCGTGTCCTTCCTGCAGG - Intronic
1179573376 21:42291587-42291609 GGGCACCATGACCTCCCTGGTGG + Exonic
1180137570 21:45871325-45871347 GGGCTGCATGGCCTTCCTGGGGG - Intronic
1180197473 21:46206443-46206465 GGGCATCAGGTCAGACCTAGGGG - Intronic
1183491945 22:38121557-38121579 GGGCAGCTTCTCCTTCCTGGAGG - Intronic
953442901 3:42934853-42934875 GGGATTCATGTCTTTTCTAGCGG + Intronic
956612948 3:71143006-71143028 GGTCACCATGTCGTTCCTTGTGG - Intronic
966290730 3:178354954-178354976 GAGCATAATGTCCTTCAGAGGGG + Intergenic
968771528 4:2510667-2510689 GGGCAGGATGTCCTGCCCAGGGG + Intronic
976624823 4:87168258-87168280 GGCCTTCAGGTCCTTCCTTGAGG + Intronic
976798014 4:88956698-88956720 AGGGGTCAGGTCCTTCCTAGGGG + Intronic
982043944 4:151422955-151422977 GGGAATCATTTTCTTCCTAAAGG + Intronic
985159228 4:187026837-187026859 GGGCACCATGCCTTTCATAGGGG + Intergenic
985585416 5:730453-730475 GGGCATCATCTGCTTCCTGTGGG + Exonic
985598927 5:814780-814802 GGGCATCATCTGCTTCCTGTGGG + Exonic
986654548 5:9998624-9998646 GGGCAACATGTCCTTCTCTGGGG - Intergenic
990008709 5:50969964-50969986 GGGGATCCTGTCCCTCCCAGAGG - Intergenic
992217267 5:74538355-74538377 GGGCTGCATGTACTTCCTAATGG + Intergenic
995502482 5:112822969-112822991 GGCCATGCTTTCCTTCCTAGTGG + Intronic
995650718 5:114364085-114364107 AGCCATCATGTCCTTGCTTGAGG + Intronic
997282061 5:132655754-132655776 GGGCATCATGTCTTTGCCAACGG + Intergenic
997753792 5:136375288-136375310 GAGCAGCAGGTCCTTCCTCGCGG - Intronic
1002915639 6:1525931-1525953 GGGCACCATGACCTTCCCAAAGG + Intergenic
1005978802 6:30820243-30820265 GGGCAACAAGTCCTTCCTTGGGG - Intergenic
1007935761 6:45730429-45730451 AGGCAGCATGTCCCTCCCAGAGG - Intergenic
1013353023 6:109323019-109323041 AGCCAAGATGTCCTTCCTAGAGG + Intergenic
1023559161 7:41454313-41454335 GAGCATCATGTCCCTCCATGAGG + Intergenic
1034430034 7:151036608-151036630 AGACCTCATGTCCTTCCTGGTGG + Exonic
1038220633 8:25603727-25603749 CGGCATCATGTTCTTCCCACAGG - Intergenic
1045254078 8:100504894-100504916 GGACATCATTTCCTTCCTACTGG - Intergenic
1047774022 8:128054244-128054266 GTGCATCATGCACTTCCTGGTGG - Intergenic
1049377307 8:142295362-142295384 GGGCATGGTGTCCTCCCTGGAGG + Intronic
1054455554 9:65428501-65428523 AGGCACCATGTGCTTCTTAGGGG + Intergenic
1055728542 9:79257578-79257600 TGGGATCAGTTCCTTCCTAGGGG + Intergenic
1187460140 X:19479173-19479195 GGGCAACACATCCTTCCTTGAGG - Intronic
1188683166 X:33037291-33037313 GAGCATCATGACCTTACAAGAGG - Intronic
1189163852 X:38839433-38839455 GGGAATTATGTCCTTACTAGAGG + Intergenic
1191191026 X:57667406-57667428 AGGCATCATGTCTTTCCAGGGGG - Intergenic
1195931489 X:110081838-110081860 GGCCAGCATGTTCTTCCTGGAGG + Intronic
1198186833 X:134261158-134261180 GGGCAGCATCTCCTTCCTTAAGG + Intergenic
1199780292 X:151052117-151052139 TGGCATCAAGGCCTTCCCAGGGG - Intergenic