ID: 1088812486

View in Genome Browser
Species Human (GRCh38)
Location 11:113400941-113400963
Sequence CCCCCTCTGGAGATGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088812472_1088812486 30 Left 1088812472 11:113400888-113400910 CCACCTTTTGCCACTCGCTTCTG No data
Right 1088812486 11:113400941-113400963 CCCCCTCTGGAGATGGAGGGAGG No data
1088812474_1088812486 20 Left 1088812474 11:113400898-113400920 CCACTCGCTTCTGAGTTCACAGG No data
Right 1088812486 11:113400941-113400963 CCCCCTCTGGAGATGGAGGGAGG No data
1088812479_1088812486 -6 Left 1088812479 11:113400924-113400946 CCTTGCATCCTAGCAGACCCCCT No data
Right 1088812486 11:113400941-113400963 CCCCCTCTGGAGATGGAGGGAGG No data
1088812473_1088812486 27 Left 1088812473 11:113400891-113400913 CCTTTTGCCACTCGCTTCTGAGT No data
Right 1088812486 11:113400941-113400963 CCCCCTCTGGAGATGGAGGGAGG No data
1088812478_1088812486 -5 Left 1088812478 11:113400923-113400945 CCCTTGCATCCTAGCAGACCCCC No data
Right 1088812486 11:113400941-113400963 CCCCCTCTGGAGATGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088812486 Original CRISPR CCCCCTCTGGAGATGGAGGG AGG Intergenic
No off target data available for this crispr