ID: 1088814797

View in Genome Browser
Species Human (GRCh38)
Location 11:113413483-113413505
Sequence GCCTCAAACAAGAGAACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088814797_1088814801 29 Left 1088814797 11:113413483-113413505 CCATAGGTTCTCTTGTTTGAGGC 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1088814801 11:113413535-113413557 TGCAGCCTCACTATGTGCCTAGG 0: 1
1: 0
2: 3
3: 26
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088814797 Original CRISPR GCCTCAAACAAGAGAACCTA TGG (reversed) Intronic
905401950 1:37710149-37710171 GCCTAAAAGAAGACAACCTGGGG + Intergenic
906079778 1:43077650-43077672 CCCTTAAAAAAGAGAACCTGAGG - Intergenic
907197137 1:52696173-52696195 GTCTCAAAAAAAAGAACCTGGGG - Intronic
912569965 1:110614165-110614187 ACCTCAAAGAAGAGAAGCCATGG - Intronic
913554533 1:119951746-119951768 GCCTTAAAGTAGAGAAACTATGG + Intronic
915160126 1:153913351-153913373 GCCTCACAGAAGAGAAACAATGG + Intronic
917995397 1:180433754-180433776 GCCTCAGGAAAGAGAATCTATGG + Intronic
918305203 1:183239849-183239871 GCCTCAAACAAGCTAATCTGGGG - Intronic
920506115 1:206516787-206516809 CCCTCAAAGAAGAGAACACAGGG - Intronic
922268094 1:224006191-224006213 CCCTCTAAAAAGGGAACCTAGGG - Intergenic
923331761 1:232931760-232931782 GCCTCCTTCAAAAGAACCTAGGG + Intergenic
924220647 1:241871885-241871907 GCCTCAGAAAAGAAAACATAAGG - Intronic
1065471181 10:26082785-26082807 CCCTGAAACAAGTGAAACTAAGG - Intronic
1066725603 10:38389418-38389440 CCCTCTAAAAAGGGAACCTAGGG + Intergenic
1072440501 10:95449813-95449835 GCTTCAAACAACAGAATTTAGGG + Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1079742167 11:24076378-24076400 GCCTGAAGCCAGTGAACCTAAGG - Intergenic
1082804065 11:57435974-57435996 GCCTCAAAAAAGAAAAAATATGG - Intergenic
1085143246 11:74169478-74169500 GCCTCAAAGAAGAAAATATATGG + Intronic
1087524612 11:99294212-99294234 GGCACAAACAAGAGAAACTTTGG - Intronic
1088814797 11:113413483-113413505 GCCTCAAACAAGAGAACCTATGG - Intronic
1092206767 12:6619606-6619628 GCCTAATACAAGAGTTCCTATGG - Exonic
1096074671 12:48795606-48795628 TCCTCAAACTAGAGCTCCTATGG - Intergenic
1096298418 12:50404222-50404244 GTCTCAAAAAAAAGAAACTAAGG + Intronic
1103025157 12:117567764-117567786 GGCTCAAACAAGAGACCACAGGG - Intronic
1103025169 12:117567890-117567912 GGCTCAAACAAGAGACCACAGGG - Intronic
1105241499 13:18612731-18612753 GCCTGAAAAAATAGAAGCTAAGG - Intergenic
1109203576 13:59457467-59457489 GCCTCAAATAAGAGAAGCCCTGG + Intergenic
1111005859 13:82247961-82247983 GCCTCAAAAAAAAGAAACAATGG - Intergenic
1111556483 13:89887795-89887817 GTCTAAAACAAGAGAACTAAAGG - Intergenic
1114555888 14:23562162-23562184 GGCTCAAAAACAAGAACCTAAGG + Intronic
1114669881 14:24404482-24404504 ACCTGAAAGAAGAGAAACTAGGG - Intronic
1120254041 14:82095438-82095460 GCCTCAAACAAGATAATCTCTGG - Intergenic
1120757330 14:88256398-88256420 GCCTCAAACCAGAGAAGCAGCGG + Intronic
1122244883 14:100395351-100395373 GGATTAAACAAGAGAACCCACGG + Intronic
1124893761 15:33757282-33757304 GCCTCAAACCAGAGTCCTTAAGG - Intronic
1129953486 15:79612403-79612425 GCCTCAAAGCAGACAGCCTAAGG + Intergenic
1130565222 15:84988404-84988426 TCCTCAAACACAGGAACCTAAGG - Intronic
1131338597 15:91573888-91573910 GTCTCAAACAGGAGAAATTACGG + Intergenic
1135039219 16:19105034-19105056 TCCTCAGAAAACAGAACCTAAGG - Intergenic
1138663680 16:58543887-58543909 GCCTGAAACAAGGGAATCTGGGG + Exonic
1138974734 16:62190421-62190443 ATCTCAAGGAAGAGAACCTAAGG + Intergenic
1140071951 16:71658087-71658109 TAATCAAAGAAGAGAACCTAGGG + Intronic
1147872398 17:43596840-43596862 ACCTCAAACAAGAGCTGCTAAGG - Intergenic
1150368250 17:64611111-64611133 GAGTGAAATAAGAGAACCTAGGG - Intronic
1156197971 18:34797275-34797297 GCCTTAAAAAAGATAACCTCTGG - Intronic
1164067326 19:21729079-21729101 GTCACAGACAAGAGAACCTTGGG + Intronic
1168629651 19:57947129-57947151 GCCTCAGAGAAGAGCATCTATGG + Intronic
934627028 2:95868908-95868930 GGATCAAACAAGACAAACTAGGG - Intronic
937970645 2:127546306-127546328 GGCTCAAATGAGAGAACCTGTGG + Intronic
939933620 2:148261211-148261233 GCCTCTAACAAGAGAATCAGTGG + Intronic
941940467 2:171031884-171031906 GCCTCAAAGAACACAAACTATGG + Intronic
942395554 2:175544206-175544228 GGCTCAAACAAGACATCATAGGG - Intergenic
943179901 2:184528676-184528698 TCCTCAAACAAGAGAATGAAAGG + Intergenic
944051875 2:195479008-195479030 GTCTCAAAAAAGAAAAGCTAAGG + Intergenic
948953337 2:241269564-241269586 GCCACAAACCAGAGACACTATGG + Intronic
1172425987 20:34856524-34856546 GCCCAAATCAAGAAAACCTATGG + Intronic
1182295265 22:29308454-29308476 GTCTCAAACATGAGCACCTCCGG - Exonic
949325853 3:2863397-2863419 GCCTCAAACAGAAGATGCTAAGG - Intronic
953591291 3:44257330-44257352 GTCTCAAAAAAGAAAACATAGGG + Intronic
954079977 3:48207865-48207887 GCTTCAAGCAAGAGACCCTCCGG - Intergenic
956205620 3:66751984-66752006 CCCTCATACAAAATAACCTATGG - Intergenic
956462670 3:69486944-69486966 GACTCAAACAAGAGACCTTGGGG - Intronic
957251332 3:77774515-77774537 GCCTCAAACAGTAGCCCCTAAGG - Intergenic
961513214 3:127416595-127416617 GCCTCAAACAATAAAACTTCTGG + Intergenic
962153341 3:132916881-132916903 GCATCAAATAATAGAACCTGAGG + Intergenic
962611079 3:137076709-137076731 GCCCCCATCAAGAGAACTTAAGG - Intergenic
962882040 3:139587385-139587407 GCCTGAGACAAGAGAAGCTGAGG + Intronic
967495453 3:190139335-190139357 TCCTCAAAGAAGACAATCTAGGG + Intergenic
971074731 4:23134270-23134292 GGCTCCCACAAGAGAAACTACGG - Intergenic
973340752 4:49001400-49001422 GCCTCAAACAAAAGCAGTTAAGG + Intronic
974566055 4:63579395-63579417 TCCTCAAACAAGAGAAAGAAAGG + Intergenic
977354629 4:95929959-95929981 GCCACAAATAACAGAACCCAAGG - Intergenic
978838109 4:113177509-113177531 ACACCAAAAAAGAGAACCTAAGG + Intronic
978970044 4:114792594-114792616 CCCTTAAACAAGAGAACCCCAGG + Intergenic
980884795 4:138751016-138751038 GCTACAAACAAGAGAAACTTTGG - Intergenic
985289762 4:188375751-188375773 GCCTTATACAAGAAAGCCTAGGG + Intergenic
989499264 5:42147427-42147449 GCCTCAAACCAGAAAACAAAAGG - Intergenic
992533580 5:77674980-77675002 GCCTCAAAAATTATAACCTAAGG + Intergenic
994586799 5:101719165-101719187 ACCTCACACCAGAGAACGTAAGG + Intergenic
996691115 5:126341059-126341081 GCTTCCAAGAAGAGAACCTTTGG + Intergenic
997973151 5:138420837-138420859 GCCTCCAACAACAAAACCGAAGG + Exonic
998525543 5:142839964-142839986 GCCTCAACCAAAAGAACATGGGG - Intronic
998546022 5:143028683-143028705 GCCTCAAAAAGGTGAAGCTAAGG + Intronic
1001403480 5:171460272-171460294 GCCTCAAGCAAGCGTGCCTAAGG - Intergenic
1006424736 6:33956893-33956915 ACCTCAAGCAATAGAACCTCAGG - Intergenic
1011181281 6:84624217-84624239 ACCCCAATCAACAGAACCTATGG + Intergenic
1011790706 6:90895321-90895343 GCCTCAAAGAGGAGAACCCTTGG - Intergenic
1012746202 6:103092676-103092698 ATCTCAAACAACAGAACATAGGG - Intergenic
1015506177 6:133991223-133991245 GCCTCAAAAAAGAAAACCCCAGG - Exonic
1017065389 6:150524106-150524128 GCCTCAAAGAAGAGAGTCTGGGG - Intergenic
1020057242 7:5126439-5126461 GCCTGAAACAAGAGGACATCCGG + Intergenic
1020170515 7:5841225-5841247 GCCTGAAACAAGAGGACATCCGG - Intergenic
1024067716 7:45755490-45755512 CCCTCTAAAAAGGGAACCTAGGG + Intergenic
1030812531 7:113991743-113991765 GCCTCAAAAAATAGAACTAAAGG + Intronic
1031784565 7:126013386-126013408 GGTTCAAACAAGAGACCCTGGGG - Intergenic
1035292139 7:157845979-157846001 TCCTCAAACAACACAAACTACGG + Intronic
1035437640 7:158871121-158871143 GCCTGAAACAAGAGAACAAAGGG - Exonic
1037929499 8:22869532-22869554 GCCCAAAACAAGAGCAGCTATGG - Intronic
1037997455 8:23363674-23363696 GCTGCAAACCAGAGACCCTAAGG + Intronic
1042674150 8:71300687-71300709 GCTTCTAATAAGAAAACCTAGGG + Intronic
1043530708 8:81147027-81147049 GCCTCAAGCAAGAGCATCTCAGG + Intergenic
1044088055 8:87966160-87966182 GTCTGAAACAGGAGAAACTATGG - Intergenic
1047079701 8:121446012-121446034 GCCTTTAAAAAGAGAATCTATGG + Intergenic
1049533152 8:143166498-143166520 GCCTCCAGCAAGAGAACTCAAGG + Intergenic
1049870908 8:144975137-144975159 ACCTCAAAGAAGAGATCCTTGGG + Intergenic
1052327713 9:27233334-27233356 GCCTGAAACATGAGAACATGTGG - Intergenic
1060132589 9:121119135-121119157 GTCTAAAACAAAACAACCTAGGG + Intronic
1061698690 9:132398074-132398096 GCCATAAACAAGATAACCCATGG - Intronic
1186831673 X:13396564-13396586 GCCTGAAGGCAGAGAACCTAAGG - Intergenic
1188917572 X:35932049-35932071 GCCTCAAAAAAGAGAAAGGAGGG - Intronic
1189197301 X:39162916-39162938 GCCGCAATAAAGAGAACCTAAGG - Intergenic
1189367131 X:40397504-40397526 CCCTCATAAAAGAGATCCTAGGG - Intergenic
1191191018 X:57667362-57667384 GTCTCAAAGCAGGGAACCTAAGG - Intergenic
1193319302 X:80102065-80102087 GCCACAACAAACAGAACCTAAGG - Intergenic
1199489684 X:148384543-148384565 ACCTCAAACAACAAAACCTCTGG + Intergenic
1199887644 X:152037042-152037064 GCCACAAAAAACAGAACCCAAGG + Intergenic