ID: 1088817038

View in Genome Browser
Species Human (GRCh38)
Location 11:113428486-113428508
Sequence TGAGGGCTGTGGTCCTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 318}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088817026_1088817038 17 Left 1088817026 11:113428446-113428468 CCAAAAACTGTCAGTTGCCAACA 0: 1
1: 0
2: 1
3: 11
4: 177
Right 1088817038 11:113428486-113428508 TGAGGGCTGTGGTCCTGCAGGGG 0: 1
1: 0
2: 3
3: 37
4: 318
1088817033_1088817038 -8 Left 1088817033 11:113428471-113428493 CCCAGTAGATGGGGATGAGGGCT 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1088817038 11:113428486-113428508 TGAGGGCTGTGGTCCTGCAGGGG 0: 1
1: 0
2: 3
3: 37
4: 318
1088817034_1088817038 -9 Left 1088817034 11:113428472-113428494 CCAGTAGATGGGGATGAGGGCTG 0: 1
1: 0
2: 1
3: 17
4: 204
Right 1088817038 11:113428486-113428508 TGAGGGCTGTGGTCCTGCAGGGG 0: 1
1: 0
2: 3
3: 37
4: 318
1088817030_1088817038 0 Left 1088817030 11:113428463-113428485 CCAACACTCCCAGTAGATGGGGA 0: 1
1: 0
2: 9
3: 37
4: 360
Right 1088817038 11:113428486-113428508 TGAGGGCTGTGGTCCTGCAGGGG 0: 1
1: 0
2: 3
3: 37
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088817038 Original CRISPR TGAGGGCTGTGGTCCTGCAG GGG Intronic
901391380 1:8948517-8948539 TGGGGGCTGTGTTCCTGTTGGGG + Intronic
901849525 1:12006749-12006771 TGAGGGCTAGGTTCCTGCTGTGG + Intronic
901917283 1:12509556-12509578 TGAGGGCTGTGGTCCTGAAAGGG + Exonic
901929156 1:12585835-12585857 TGTGGGTTGGGGGCCTGCAGAGG + Intronic
902273787 1:15325214-15325236 TGAGGAATGTGGTCCCCCAGGGG + Intronic
902570862 1:17346330-17346352 TGACTGCAGTGGGCCTGCAGTGG - Intronic
902951166 1:19883576-19883598 TGAGTGCTCAGATCCTGCAGAGG + Intronic
903627917 1:24744909-24744931 TGAGTCCTGGGGTGCTGCAGCGG + Intergenic
903704164 1:25272751-25272773 GGAGGCCTGTGGTTCTCCAGGGG + Intronic
903864523 1:26388606-26388628 TGAGGGCTGGGGACCCTCAGAGG - Intergenic
904040786 1:27583606-27583628 TGAGGGCATTGATCCAGCAGAGG - Intronic
904602974 1:31683861-31683883 TGGGGGCAGTGGGCCTGGAGTGG - Intronic
905212727 1:36385699-36385721 TGAGGGCAGGGGTCCAGGAGCGG - Intronic
905224671 1:36471538-36471560 TGAGCTCTGTGGTGTTGCAGAGG + Exonic
906097445 1:43233964-43233986 TAAGGCCTGTGGTCCTGAAAGGG + Intronic
906289557 1:44610863-44610885 AGGGGGCTGTGGTCTTGCTGGGG - Intronic
906662111 1:47590423-47590445 TGAGCCCTGTGCTCCTGGAGTGG + Intergenic
907334010 1:53688648-53688670 TGGGGGCTGTGGGCCTGCCCTGG - Intronic
907491614 1:54812225-54812247 TGAGGCCTGTCATCCTGCTGGGG - Intronic
911044440 1:93617038-93617060 TGAGGGCAGTGCTTATGCAGGGG - Intronic
911234526 1:95397121-95397143 TCAGGCCTGTTGTCCTACAGAGG + Intergenic
912388391 1:109284282-109284304 TGAGGACTGAGGACCTCCAGAGG - Intergenic
912551193 1:110486509-110486531 GGAGGGCTGCAGGCCTGCAGAGG + Intergenic
912756433 1:112328759-112328781 AGAGGGCGGTGCTGCTGCAGCGG - Intergenic
915754737 1:158248887-158248909 TGAGAGCTGTAGTCCTACTGTGG - Intergenic
917980717 1:180267267-180267289 CGTGGGCAGTGGCCCTGCAGTGG - Intronic
921616133 1:217270085-217270107 TGAGGGCTGTGGGACTCCAAGGG - Intergenic
922507423 1:226134632-226134654 TGAGGGCAGTGGTCCAGGTGGGG - Intergenic
922897327 1:229110625-229110647 TGAGGGCTGTGATTCTTCACTGG - Intergenic
924207227 1:241725692-241725714 TGAGGGCTGCTGGCCTGCTGGGG - Intronic
1063117395 10:3081331-3081353 AAAGGACTGTGGTCCTGCAGGGG - Intronic
1063462260 10:6222196-6222218 AGAGGACAGTGGGCCTGCAGGGG - Intronic
1064982365 10:21177331-21177353 TGAAGGCTGTGGGCTTGCTGTGG - Intergenic
1065413979 10:25464319-25464341 CCAGGGCTGTGGTCATGCTGTGG - Intronic
1065751413 10:28890997-28891019 TGAGAGCTGAGGGTCTGCAGGGG + Intergenic
1067082540 10:43219665-43219687 TCAGGGCTGAGGGCCTCCAGAGG + Intronic
1067749706 10:48962700-48962722 TGGGAGCTGTGGTCCTGAATGGG + Intronic
1069062739 10:63911256-63911278 TCTGGCTTGTGGTCCTGCAGTGG - Intergenic
1069683147 10:70299548-70299570 TGTGGTCTGTGGACCAGCAGCGG - Exonic
1069855536 10:71438993-71439015 TCAGGGCCCTGGTCCTCCAGCGG - Intronic
1071261398 10:83922651-83922673 TGAGTGCCTTGGTCCTGAAGGGG + Intergenic
1074412600 10:113241416-113241438 TGAGAGCTGTGGTCACCCAGAGG + Intergenic
1074825928 10:117215954-117215976 TGAGGGCTGGGGTCCTGGGCAGG + Intergenic
1075268983 10:121032655-121032677 TGAGGCCTGGGCTACTGCAGGGG - Intergenic
1075556494 10:123436150-123436172 TGAGAGCCGTGGTCTTCCAGTGG - Intergenic
1075735652 10:124663211-124663233 TGATGGCTTTGGTCATGCACAGG - Intronic
1075997751 10:126892401-126892423 TGAGGGCGTTTGTCCTCCAGTGG - Intergenic
1076590081 10:131576879-131576901 TGGGGGCTCTTCTCCTGCAGCGG + Intergenic
1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG + Intronic
1077054516 11:584465-584487 TGAGAGCTGTGGGCGTCCAGGGG + Intronic
1078329040 11:10403518-10403540 TCAGGGCTTTTGGCCTGCAGAGG + Intronic
1078441558 11:11372616-11372638 TGAGGGCAGGGCTCCTGCAGGGG + Exonic
1081555502 11:44157305-44157327 TGAGGCCTGCTGTCCTGCAGAGG - Intronic
1082935159 11:58648270-58648292 TGAGAGATGTTGGCCTGCAGTGG + Intronic
1083316052 11:61815679-61815701 TGAGGGCTGTGGTCTAGAAAGGG + Intronic
1084169410 11:67393416-67393438 TGATGGGTGTGGGCCTGCATGGG + Intronic
1084368681 11:68721723-68721745 TCAGGTCTGTGCTGCTGCAGTGG + Intronic
1084974293 11:72788080-72788102 TGAGTGCTGTGGGCCTGCTTGGG + Intronic
1088817038 11:113428486-113428508 TGAGGGCTGTGGTCCTGCAGGGG + Intronic
1089214163 11:116825632-116825654 GGAGTGGTGTGGTCCGGCAGAGG - Intergenic
1089366864 11:117925982-117926004 TGAGGGCTGCACACCTGCAGGGG + Intronic
1089515645 11:119030116-119030138 TAAGGGCTGAGGTCCTGATGGGG + Intronic
1089554977 11:119311256-119311278 TGAGGGCTGCATCCCTGCAGGGG - Intronic
1090853593 11:130592584-130592606 TGAGAGAAGTGGTCCTGCTGGGG - Intergenic
1091724031 12:2833428-2833450 TCTGGGCTGTGGTCCTGGTGGGG + Intronic
1092284778 12:7122368-7122390 TGGAGGATGGGGTCCTGCAGTGG + Intergenic
1092528984 12:9328624-9328646 TGAGGGCGGTGCGGCTGCAGGGG + Intergenic
1095123617 12:38447893-38447915 TGAGGGCTGCTGTCCTTCAAAGG + Intergenic
1095595359 12:43951734-43951756 TGAGGGCTCTGATCCTGATGAGG + Intronic
1096084602 12:48857324-48857346 TGGGGGTGGTGGTGCTGCAGGGG - Exonic
1096788417 12:54030908-54030930 AGAGGGCTGGGGGCTTGCAGGGG - Intronic
1097571255 12:61335084-61335106 TTAGGGCTCTGCCCCTGCAGTGG + Intergenic
1102150939 12:110688924-110688946 CGAGGGCTGGGGTCCTGCTGGGG + Intronic
1102201589 12:111061094-111061116 TCATGGCTGTGGCCCTGCAGAGG + Intronic
1103916213 12:124376942-124376964 GAAGGGCTGAGGTCCTCCAGGGG + Intronic
1104391809 12:128397264-128397286 TGAAGGCTTTGGTCCCACAGAGG + Intronic
1104651940 12:130541101-130541123 TGAACTCTGTGGCCCTGCAGTGG - Intronic
1104725908 12:131075642-131075664 TGAGTCCTTTGGTTCTGCAGTGG + Intronic
1104962294 12:132493979-132494001 GCAGGGCTGAGGACCTGCAGAGG + Intronic
1105280670 13:18960874-18960896 TGAGAGATGTGCTCCTGCTGTGG + Intergenic
1105528892 13:21200487-21200509 TGAGGGCTCTGCCCCTGCAGTGG + Intergenic
1105809661 13:23983844-23983866 TCAGGCCTGTGGTGCTGCACAGG - Exonic
1105930023 13:25043610-25043632 TCAGGCCTGTGGTACTGCACAGG + Intergenic
1108155211 13:47577364-47577386 TGAGGGCTCTGCCCTTGCAGTGG + Intergenic
1108167538 13:47709170-47709192 TGAGGGCTGATGTCCAGCTGGGG - Intergenic
1110120534 13:71874831-71874853 TGAGGGCTGTGGGACTGGGGAGG + Intergenic
1112433479 13:99373635-99373657 TCAGGGCAGTGGTGTTGCAGAGG + Intronic
1112819542 13:103315172-103315194 TGAGTGCTGTGGTTATGGAGTGG + Intergenic
1113522754 13:110952428-110952450 TGTGCCCTGTGTTCCTGCAGTGG + Intergenic
1113702616 13:112398409-112398431 TGTGCCCTGTGTTCCTGCAGTGG - Intronic
1113851004 13:113418047-113418069 TGAGGGCTGTGGTGGTGGTGAGG + Intergenic
1114235583 14:20820788-20820810 TGAGTGCCGTGTTCCTGAAGTGG + Intergenic
1116471581 14:45291804-45291826 TAAGGGCTGGGGTGCTGGAGGGG + Intergenic
1116978634 14:51143461-51143483 TGAAGCCTGTGGTTCTGGAGTGG + Intergenic
1117665303 14:58050349-58050371 TGAGGACTGTGGTCCTCCTTAGG - Intronic
1118814279 14:69298850-69298872 TGGAGGCTTTTGTCCTGCAGAGG + Intronic
1118887567 14:69879548-69879570 AGCGGGCCGTGGTCCTGCGGCGG - Exonic
1118921503 14:70153522-70153544 TGAGGGCTGTGGCCATACAGAGG - Intronic
1122438828 14:101716511-101716533 GGAGAGCTGGTGTCCTGCAGGGG - Intergenic
1123699234 15:22902360-22902382 TGATGTATGTGGTACTGCAGGGG + Intronic
1124415745 15:29471976-29471998 TGAGGGCTGGGGTGGAGCAGAGG + Intronic
1125225351 15:37389570-37389592 TGAGGGCTCTGCCCCTGCAGTGG + Intergenic
1125483182 15:40094324-40094346 GGAAGGCTGAGGTCTTGCAGGGG + Intronic
1128082195 15:64863368-64863390 TGAGGGATAGGATCCTGCAGAGG + Intronic
1128552608 15:68608197-68608219 GGATGCCTGTGGGCCTGCAGTGG - Intronic
1128673241 15:69590273-69590295 TGTGGGCTGAGGTCCCTCAGTGG - Intergenic
1128969261 15:72092535-72092557 GGTGGGCAGTGGTCGTGCAGTGG - Intronic
1129267720 15:74402981-74403003 TGAGGGCTGTGGTGAGGCTGTGG + Intergenic
1129325432 15:74798038-74798060 TGAGGGCTGAGGACCCCCAGGGG - Intronic
1129465660 15:75722866-75722888 TGAGGCCTGTGGTCCCTCAGGGG + Intergenic
1130967691 15:88709473-88709495 CTAGGGCAGTGGTCCAGCAGGGG - Intergenic
1131400504 15:92121909-92121931 TGAGGGCTGTGTCCCTGAAGTGG + Intronic
1131915043 15:97255931-97255953 TGATGGCTGGACTCCTGCAGTGG + Intergenic
1132064905 15:98722795-98722817 AGAGGTCTGTGGGCATGCAGTGG + Intronic
1132380231 15:101361046-101361068 TGAAGGCTGTGTTCTTGGAGGGG + Intronic
1133264431 16:4574928-4574950 TGAGGGCTGTGAGCCTGGAGGGG - Intronic
1133760723 16:8796508-8796530 CATGGGCTGTGGTGCTGCAGTGG - Exonic
1134030436 16:10988344-10988366 TGAGGGATGTGGTGGTGCACTGG + Intronic
1134063336 16:11211850-11211872 GGAGGGCTATGGGCTTGCAGTGG + Intergenic
1137883785 16:52080151-52080173 TTAAGCCTGTGTTCCTGCAGAGG - Intergenic
1138222929 16:55268377-55268399 TGAGGGCTGAGATTCTTCAGAGG - Intergenic
1138393163 16:56684642-56684664 TGAGAGCTGCATTCCTGCAGAGG + Intronic
1139368731 16:66451380-66451402 GGAGGGCTGAGGGCCTGCACAGG - Intronic
1139515231 16:67448888-67448910 TGGGGGCTGTAGGCCTGCTGTGG - Intronic
1141563447 16:84885510-84885532 AGAAGGCCGTGGACCTGCAGGGG - Intronic
1142101801 16:88275994-88276016 GCAGCGCTGTGGTCCTGCCGGGG - Intergenic
1142138467 16:88462062-88462084 GGAAGGCAGTGGTCCTGCTGAGG + Intronic
1142149419 16:88506111-88506133 TGAGGTTTGTGGCCCAGCAGAGG + Intronic
1142249935 16:88986570-88986592 TGGGGGCTGTGGGGCTGTAGGGG - Intergenic
1142479332 17:208530-208552 AGAGGGCTTTGGTCCTACAGAGG + Intergenic
1143165748 17:4896544-4896566 TTAAGGATGTGGTGCTGCAGTGG + Exonic
1143576838 17:7798772-7798794 TGGGAGCTGTGGTCCTTCTGGGG - Intronic
1144772496 17:17767663-17767685 TGTGTGCTGTGATCCTTCAGGGG + Intronic
1144774415 17:17777877-17777899 TCAGAGCTTGGGTCCTGCAGTGG - Intronic
1144955153 17:19015376-19015398 TGAGGGCTGTGATCACACAGAGG - Intronic
1145292846 17:21563551-21563573 TCAGAGCTGTGGTCCTGCAATGG + Intronic
1145387115 17:22422384-22422406 TCAGAGCTGTGGTCCTGCAATGG - Intergenic
1145762666 17:27435045-27435067 TGAGGGCCCTGATCCTGAAGTGG - Intergenic
1147359365 17:39921508-39921530 TAAGGGGTGAGGGCCTGCAGAGG + Intronic
1147673773 17:42191395-42191417 AGAGTGCTGTGGTCCTGGAGGGG + Intronic
1150298721 17:64030565-64030587 TGAAGGCTGTGGTCCAGAAGAGG + Intergenic
1152945961 17:83197406-83197428 GCAGGGATGGGGTCCTGCAGAGG - Intergenic
1154001060 18:10482698-10482720 TCAGGCCTGTGGTCCTGGTGTGG - Intronic
1157594098 18:48853360-48853382 TGAGGTCTGTGGATCTGCGGTGG + Intronic
1160187354 18:76686043-76686065 TGAGGACTGTGTCCCTGGAGTGG - Intergenic
1160190247 18:76709171-76709193 TGAGGGCTGGGGGCCTTGAGAGG - Intergenic
1160594641 18:79964973-79964995 GGAGGCCTGTGGTCCTGGGGGGG + Intronic
1161083426 19:2322661-2322683 TCACTACTGTGGTCCTGCAGTGG + Intronic
1162717707 19:12644323-12644345 GGTGGGCTGTCATCCTGCAGAGG - Intronic
1162917323 19:13881430-13881452 TGAGGCCTGTGGTCTGGCAGCGG + Intergenic
1163366249 19:16877618-16877640 TGAAACCTGTGTTCCTGCAGAGG + Exonic
1163617765 19:18340044-18340066 TGCGGGGTGTGTTCCGGCAGAGG + Intergenic
1163832720 19:19554710-19554732 TGACGGCTGTGTCCATGCAGGGG - Intergenic
1165062230 19:33210598-33210620 TGACGGCTGTGGCCCCGCACTGG + Exonic
1165452215 19:35890280-35890302 TGGGGGCTGTGGACGTGGAGGGG - Intronic
1166232990 19:41436503-41436525 TGAGGGCTGTGGTGCTCCCCAGG - Intronic
1166412332 19:42564188-42564210 TGTGGGCTTTGCTACTGCAGGGG + Intergenic
1168027986 19:53657418-53657440 TGAGGGGAGTGGTCAGGCAGAGG + Intergenic
925125297 2:1450414-1450436 TGAGGTCTGTGCTCCTGCTGAGG - Intronic
925364486 2:3302674-3302696 GGAGGGCTGTGGATCCGCAGCGG - Intronic
925579951 2:5400253-5400275 TGAGGGCTGTTCTCCTTCACTGG + Intergenic
925581575 2:5416633-5416655 TGAGACCTCTGGTCCAGCAGAGG + Intergenic
925661436 2:6207465-6207487 TGAGGGGCTTGGTCCTGCAAAGG + Intergenic
926219326 2:10924662-10924684 AGATGGCTGTGGTGCTGCCGAGG + Intergenic
926981506 2:18576494-18576516 TGAGGTCTGTGGTTGTGAAGAGG - Intronic
927437251 2:23077506-23077528 TGAGGGCTTTGGTGGTGCTGGGG - Intergenic
927453692 2:23231039-23231061 TGGGGGCTGCTGGCCTGCAGAGG - Intergenic
927634156 2:24799813-24799835 TGAGGGCTGTGGTGCGGCACCGG + Exonic
929044472 2:37776583-37776605 TGGGGGCTTTGGTACAGCAGGGG + Intergenic
929530598 2:42749189-42749211 TGAGGGAGGAGATCCTGCAGAGG - Intronic
929584087 2:43102480-43102502 TGAGGCCTGTGGTCCTGCTTGGG - Intergenic
929868937 2:45741690-45741712 TGCGGGCTGTGGTCTTGGAAGGG + Intronic
929917768 2:46150531-46150553 TGAGCCCTGTGCTCCTGGAGAGG - Intronic
931224689 2:60319484-60319506 TGAGTGGTGTGGTCCTGGACAGG - Intergenic
932428965 2:71662057-71662079 GGAGGGGTGTGTTCCTGCACTGG - Intronic
932586606 2:73034113-73034135 TGTGGGCTGGGTCCCTGCAGTGG - Intronic
933236456 2:79870207-79870229 TCAGAGCTGTGTTCCTACAGTGG - Intronic
935549377 2:104435733-104435755 TGAGGGGAGTGGTGCTCCAGGGG + Intergenic
935833600 2:107025653-107025675 TCAGGGCTGTGGGCTTGCTGTGG + Intergenic
937087669 2:119182108-119182130 TGAGGGCTTTGGTCTCGCATTGG + Intergenic
938792858 2:134692195-134692217 GCAGGGCTGTGCTCCTGCAGAGG - Intronic
940865996 2:158818194-158818216 TGGGGGCTGGGGTCATGCTGTGG + Intronic
944383684 2:199141211-199141233 TGATGGCAGTGGCCCTTCAGAGG + Intergenic
945710079 2:213284439-213284461 GGACGGCTGTGGGCCTGCTGGGG + Exonic
946278943 2:218652102-218652124 GGCGGGCTCTGGCCCTGCAGAGG + Intronic
946359337 2:219209731-219209753 TGTGGGATGGGGTACTGCAGCGG - Intergenic
946691415 2:222311548-222311570 TAAGGACTGTGTTGCTGCAGAGG + Intergenic
947157266 2:227175096-227175118 TGAGGGATGTGGTCCAGGACAGG + Intronic
947257315 2:228181000-228181022 GGAGGACTGTGGGACTGCAGGGG + Intronic
947530341 2:230905087-230905109 TGAGGCCAGTGGGCCTGGAGTGG - Intergenic
947752584 2:232540546-232540568 CTAGGGCTGTGGTGCAGCAGAGG + Intronic
947763905 2:232623822-232623844 AGAGGGCTGAGCTCCTTCAGAGG + Intronic
947869006 2:233422079-233422101 AGTGGGCTGTGGGGCTGCAGAGG + Intronic
948656084 2:239477286-239477308 TGAGGGCTCTAGAGCTGCAGCGG + Intergenic
1168981656 20:2009111-2009133 TGAGGGCTGTTCTTCTGGAGAGG + Intergenic
1169340204 20:4790572-4790594 TGTGGGGTGTCCTCCTGCAGGGG + Exonic
1172009785 20:31839894-31839916 TGAGGGCTGTGGTCAAGAGGAGG + Intergenic
1173565603 20:44036148-44036170 TGAGTCCTGTGGTCCTGAGGGGG + Intronic
1173827269 20:46055946-46055968 TGAGGTCTGGGGTTCTGGAGAGG + Intronic
1174191165 20:48741814-48741836 TGAGGGAACTGGTCCAGCAGAGG + Intronic
1175633696 20:60562533-60562555 TTAGGGCTGTGGTGATGGAGGGG + Intergenic
1175764932 20:61585796-61585818 TGATGATTGTGGTCATGCAGAGG + Intronic
1175910871 20:62404959-62404981 TGGAGGCTCTGGGCCTGCAGGGG + Intronic
1175975342 20:62708055-62708077 TGAGGGGCTGGGTCCTGCAGAGG - Intergenic
1176098123 20:63353466-63353488 GGGGGGCTGTGGTCCTGGGGGGG + Intronic
1176098143 20:63353517-63353539 GGGGGGCTGTGGTCCTAGAGGGG + Intronic
1176098176 20:63353602-63353624 AGGGGGCTGTGGTCCTAGAGGGG + Intronic
1176098183 20:63353620-63353642 AGGGGGCTGTGGTCCTGGAGGGG + Intronic
1176098247 20:63353802-63353824 AGGGGGCTGTGGTCCTGGAGGGG + Intronic
1176098316 20:63353985-63354007 GGGGGGCTGTGGTCCTGGCGGGG + Intronic
1176098375 20:63354178-63354200 GGGGGGCTGTGGTCCTGGGGGGG + Intronic
1176098420 20:63354293-63354315 AGGGGGCTGTGGTCCTGGGGGGG + Intronic
1176098488 20:63354554-63354576 GGAGGGCCGTGGTCCTGGTGAGG + Intronic
1176166044 20:63674213-63674235 TGAGGCCCGTGCTACTGCAGTGG + Intronic
1178746079 21:35251579-35251601 TGAGTGCTGTGGAGCTGCATAGG + Intronic
1179316754 21:40250687-40250709 TGAGGGCTGCTGTGCTGCACTGG + Intronic
1179913239 21:44461070-44461092 TGCGGGGTGGGGTCCAGCAGTGG + Exonic
1180159079 21:45991057-45991079 TGAAGGCCCTGGTCCTCCAGGGG - Intronic
1181089871 22:20465202-20465224 TGGAAGCTGAGGTCCTGCAGCGG - Exonic
1181278699 22:21703450-21703472 CGTGGGCTGCGGCCCTGCAGAGG - Exonic
1181427937 22:22856165-22856187 TGGGGCCTGTGGTCCTGGGGAGG + Intronic
1181980334 22:26761551-26761573 TGAGGACTGAGGCCATGCAGTGG + Intergenic
1182458612 22:30468843-30468865 AGAAAGCTGAGGTCCTGCAGGGG + Intronic
1183081537 22:35459697-35459719 TGATCTCTGTGTTCCTGCAGCGG + Intergenic
1183829744 22:40411455-40411477 TGGGGGCTGTGGTGCTGAGGGGG + Exonic
1184177163 22:42794935-42794957 TGAGGAGTGTGGCCGTGCAGAGG - Intergenic
1184692599 22:46123992-46124014 TGGGGGAGGTGGTCCTGAAGTGG + Intergenic
1184835664 22:47019597-47019619 TGGGGGCTGTGGGCAGGCAGGGG + Intronic
1185020471 22:48371774-48371796 TGAGGACCAGGGTCCTGCAGGGG - Intergenic
1185099523 22:48830209-48830231 TGAGGGCTGAGGTCCTGGGAAGG + Intronic
1185246755 22:49776849-49776871 TCTGGGCTGTGGCCCTGCCGGGG - Intronic
1185285199 22:49996932-49996954 TGTGAACTGAGGTCCTGCAGTGG + Intronic
949618603 3:5784497-5784519 GGAGTGCAGTGGCCCTGCAGTGG - Intergenic
950392368 3:12706684-12706706 TGAGTGCCTTGGTCCTGAAGAGG + Intergenic
952040740 3:29258363-29258385 TTAGGAAAGTGGTCCTGCAGTGG + Intergenic
952824833 3:37516024-37516046 TGAGTGCTGTGGGCATTCAGTGG + Intronic
953576566 3:44117395-44117417 GGAGGTCTGTGGCCCAGCAGGGG - Intergenic
954127541 3:48540339-48540361 GGAGTGCTCTGGTCCTGCACAGG - Intronic
954467201 3:50662689-50662711 TGAGGGCTCTGGTCAGCCAGAGG - Intergenic
954869959 3:53760313-53760335 AAAAGGCTGTGGTTCTGCAGTGG + Intronic
955226193 3:57062398-57062420 TGGGGGCTGTGGTCCTGGCTGGG - Intronic
959924900 3:111910038-111910060 TGAGGGCTGTGAATCTGCAGTGG + Intronic
961505577 3:127368761-127368783 AGAAGGCAGTGGGCCTGCAGGGG + Intergenic
961551651 3:127673182-127673204 CGAGGGCTGTGACCCGGCAGAGG - Intronic
961561577 3:127733979-127734001 AGAGCGTTGTGGCCCTGCAGAGG + Intronic
961861196 3:129917953-129917975 TGAAGGCTGTGGCCCAGCAAGGG + Intergenic
965440899 3:168712756-168712778 TCAGGGCTGTGCTCTTGTAGTGG + Intergenic
966396603 3:179510327-179510349 TGAGGGCAGTGGCTCAGCAGAGG - Intergenic
966890198 3:184401700-184401722 TGAGGGCTGTAGGGCTGGAGGGG + Intronic
967197189 3:187038681-187038703 TGAGAGCTGTTTTCCAGCAGAGG - Intronic
968199219 3:196738163-196738185 TCAGGACTGTGATCCTGCATAGG - Intergenic
968501004 4:950091-950113 TATGGGCTGTGTTCCTGCTGGGG - Intronic
968680477 4:1915527-1915549 TTATGTCTGTGGCCCTGCAGAGG + Intronic
969407316 4:7002172-7002194 TGTGCGGTGTGGTCCTACAGAGG + Intronic
969604735 4:8196775-8196797 TGAGGGCTGGAGTCCAGGAGGGG + Intronic
969675952 4:8614515-8614537 TCAGGGCTCTGGTCCAGCTGTGG + Intronic
971605307 4:28651210-28651232 CAAGGGCTGTTCTCCTGCAGAGG + Intergenic
978472672 4:109087168-109087190 TGAGGGCTGGGGTCCAGCCATGG - Intronic
979402871 4:120271929-120271951 TCAGGGATGTGGTTCAGCAGAGG + Intergenic
979486824 4:121279760-121279782 CCAGTGCTGTTGTCCTGCAGTGG - Intergenic
982421952 4:155208695-155208717 TGCGGGCGATGGTCCTGCAGGGG - Exonic
985652645 5:1114024-1114046 TGCTGGCTGTGGACCTTCAGAGG + Intergenic
986682505 5:10246797-10246819 TGAGGGGTGGGGTCCAGGAGAGG + Intronic
988263014 5:28912910-28912932 TGGGGACTCTGCTCCTGCAGTGG - Intergenic
990197512 5:53335241-53335263 TGAGGGCCTCTGTCCTGCAGGGG - Intergenic
993390970 5:87319370-87319392 TGAGGACTCTGGCCCTGTAGCGG + Intronic
998017278 5:138742422-138742444 GGAGGGCTCTGGTGTTGCAGAGG + Intronic
999098472 5:149002890-149002912 TGAGGGCTCTTGCCCTGCAGTGG + Intronic
999190202 5:149741597-149741619 TTGGGGCTGTGCTCTTGCAGTGG - Intronic
999454997 5:151707843-151707865 TGGGAGGAGTGGTCCTGCAGAGG + Intergenic
1002326624 5:178414064-178414086 TGTGTGCTCCGGTCCTGCAGTGG + Intronic
1002357231 5:178640853-178640875 TGAGTGCACTGGTCCTGAAGTGG + Intergenic
1002518844 5:179779015-179779037 AGAGGGCAGTGGGGCTGCAGAGG + Intronic
1002639906 5:180625822-180625844 TGGGGGCTGTGGCTGTGCAGGGG + Intronic
1006355753 6:33556540-33556562 AGAGTGCAGTGGTACTGCAGTGG + Intergenic
1009550598 6:65087611-65087633 TGAGTGGTGTAGTCCTGAAGTGG + Intronic
1010268261 6:73891805-73891827 TGAGGGTTCTGCCCCTGCAGTGG - Intergenic
1010301551 6:74266229-74266251 TGAAAGCTATGGTCCTTCAGAGG + Intergenic
1010340720 6:74749382-74749404 TGAGTGCTGCAGTCCTGAAGGGG - Intergenic
1014552157 6:122801494-122801516 TGGGGGCTGTGCTCCAGAAGTGG - Intronic
1015989008 6:138915910-138915932 AGAGGGCTGTGGCCTTGGAGGGG + Exonic
1016041829 6:139439630-139439652 TGATGGATGTGGTCTGGCAGAGG + Intergenic
1016417008 6:143843509-143843531 CGAGCGCTGTGGTTTTGCAGAGG + Intronic
1018150558 6:160933427-160933449 GGAGGGCTGTCATCCAGCAGAGG - Intergenic
1019019189 6:168903073-168903095 TGAGGGCTGATGTCCGGTAGGGG + Intergenic
1019644332 7:2121040-2121062 TGACGGCAGGGCTCCTGCAGAGG + Intronic
1019644854 7:2123617-2123639 TGAGGGCTGCTGCCCTCCAGCGG - Intronic
1019733496 7:2639609-2639631 TGACGGCTGTGGTCCTGGCTGGG - Intronic
1020133000 7:5570066-5570088 CAAGGCCTGGGGTCCTGCAGTGG - Intergenic
1022201122 7:28118840-28118862 AGAGGGATCTGTTCCTGCAGAGG + Intronic
1022852745 7:34282140-34282162 TGAGGGCTCTGACCCTGCAGTGG + Intergenic
1023348163 7:39292873-39292895 GGATGGCTGGGGTCTTGCAGTGG + Intronic
1024160053 7:46664651-46664673 TGATGGCTGAGGTCCAGCTGAGG - Intergenic
1030384671 7:108854280-108854302 TGAGTTCTGTGGACCAGCAGTGG + Intergenic
1030500693 7:110355826-110355848 TGAGGACTGTGGTCCTTTGGAGG + Intergenic
1031382134 7:121099810-121099832 TGAGGGCTGGCGTCCTACAAAGG + Intronic
1032839726 7:135704283-135704305 TCAGGCCTGAGGCCCTGCAGAGG + Intronic
1033216277 7:139495836-139495858 AGAGGGCTGTGGCGCTGCTGAGG - Intergenic
1033277397 7:139982727-139982749 TGTGGGCTGTGATCCTTTAGGGG - Intronic
1034077368 7:148245210-148245232 AGAGGTCTGTGGGCTTGCAGAGG - Intronic
1034529484 7:151686673-151686695 TGAGAGAGGGGGTCCTGCAGGGG - Intronic
1034628308 7:152511265-152511287 AGAGTCCTGTGTTCCTGCAGAGG + Intergenic
1034996135 7:155578263-155578285 TGTGTGCTGTGGGCCCGCAGCGG - Intergenic
1035180334 7:157084832-157084854 TGAGGGCTCTGCCCCTGCAGTGG - Intergenic
1035231527 7:157468734-157468756 TGAGGGTTTTGGTGCTGGAGTGG + Intergenic
1035258042 7:157644430-157644452 TGAGGTCTGTGGACCTCCAGGGG - Intronic
1035468152 7:159093113-159093135 TGAGAGATGTGGTCCTGCGGGGG + Intronic
1035630799 8:1105308-1105330 TTAGGGCTGTGGAACTGTAGGGG + Intergenic
1036640351 8:10579663-10579685 TGAGGGGTGTGGTTCGGCAGTGG - Intergenic
1036727408 8:11231978-11232000 GGGGGCCTGTGGACCTGCAGAGG - Intergenic
1036752274 8:11450886-11450908 TGCAGGCTCTGGGCCTGCAGTGG + Intronic
1037777795 8:21847181-21847203 GAAGAGCTGTGGTCCTTCAGGGG - Intergenic
1037855559 8:22368325-22368347 GGACGGCTGTGCTCCTGCTGAGG + Intronic
1039440266 8:37590282-37590304 TGAAGGCTGTGGTCTGGAAGGGG - Intergenic
1040007821 8:42635674-42635696 TTGGAGCTGGGGTCCTGCAGCGG - Intergenic
1040552506 8:48449472-48449494 TGAGTGCTGTGGGCCTGAAATGG - Intergenic
1044149788 8:88761242-88761264 TCAGAGCTGTAGTCCTGCATGGG + Intergenic
1048268787 8:133011383-133011405 TGAGAGCCTTGGTCCTGCAGGGG + Intronic
1049171974 8:141167093-141167115 CGAGGGCTATGGTCTAGCAGGGG + Intronic
1049340250 8:142108607-142108629 TGTGGACTGAGGTCCTCCAGGGG - Intergenic
1049442934 8:142617415-142617437 TGAGAGGAGGGGTCCTGCAGGGG + Intergenic
1049689241 8:143951558-143951580 AGAGGGCTGTGGGCTTGGAGAGG - Intronic
1050007780 9:1151966-1151988 TGTAGGCTGTGGCCCAGCAGAGG - Intergenic
1052882404 9:33611142-33611164 GGAGGGCTGAGGTGGTGCAGGGG + Intergenic
1053270520 9:36746344-36746366 TGGGGGCTGGGGTGCAGCAGGGG - Intergenic
1053293779 9:36899088-36899110 TTAGGGCTGTGGTGCTGGTGGGG - Intronic
1055636160 9:78281388-78281410 TGAGGCCTGTGTTCCTGCTGGGG - Intergenic
1056225769 9:84493694-84493716 TGAGGGCTGGAGTGCTCCAGGGG + Intergenic
1056233862 9:84572550-84572572 TGAGGGCTGGTCTCCAGCAGAGG + Intergenic
1059137240 9:111818957-111818979 TGAGGCCAGTGGACCTGGAGAGG + Intergenic
1060411367 9:123402662-123402684 TGAGGGCTGTGCTCCTTTTGCGG + Intronic
1060547394 9:124469355-124469377 TGTGAGCTGGGGACCTGCAGGGG + Exonic
1061186880 9:129060065-129060087 TGAGGGGTGTGGACCTCCAAGGG - Intronic
1061941646 9:133887185-133887207 TGAGGGCTGTGGAGGTGAAGAGG - Intronic
1062493526 9:136821082-136821104 TGAGGGCTGGTTTCCGGCAGTGG + Intronic
1203770788 EBV:49012-49034 TGCGGCCGGTGGTCCTGCGGGGG + Intergenic
1185736754 X:2501225-2501247 TGGGGTCTGTGGTCCTGGGGGGG - Intronic
1185736780 X:2501288-2501310 TGGGGTCTGTGGTCCTGAAGGGG - Intronic
1185736807 X:2501365-2501387 TGGGGTCTGTGGTCCTGGGGGGG - Intronic
1187564312 X:20433435-20433457 TGATGGCTGAGTTCCTGAAGAGG + Intergenic
1187631976 X:21183328-21183350 TGAGTCCTTTGGTCCTGAAGAGG - Intergenic
1188127118 X:26383308-26383330 TGAGGGCTCTGCCCCTGCAGCGG - Intergenic
1188926065 X:36045260-36045282 TGAGGGTTTTTGTCCTGAAGGGG + Intronic
1189247560 X:39575589-39575611 TGGGGGCTGTGGGTCTGGAGAGG - Intergenic
1190188089 X:48253420-48253442 GCAGGGCTGTAGTCCTCCAGAGG - Intronic
1193029107 X:76878970-76878992 TGAGGGCTCTGATCCTGCAACGG + Intergenic
1194365246 X:93006451-93006473 TGAGGGCTGTGCCCCTGCAGTGG + Intergenic
1194916930 X:99718384-99718406 TGATCCCTGTGGTCCTGCACTGG - Intergenic
1195379041 X:104254252-104254274 TGGGGGCTGTGGTCCCTCAGCGG + Exonic
1196866722 X:120077370-120077392 TGAGAGCAGTGGTAGTGCAGGGG + Intronic
1196876377 X:120158911-120158933 TGAGAGCAGTGGTAGTGCAGGGG - Intronic
1199609124 X:149598751-149598773 TGAGGGCGGTAGTCATGCACGGG + Intronic
1199629995 X:149770606-149770628 TGAGGGCGGTAGTCATGCACGGG - Intergenic
1199677481 X:150200304-150200326 TGAGGGCTGTGTTCCCAGAGGGG - Intergenic
1199863456 X:151822221-151822243 TGAGTGCTGTGCTGATGCAGTGG + Intergenic
1200143329 X:153912989-153913011 TGAGGGCTGGGGCCCTGCGACGG - Intronic
1200209148 X:154338388-154338410 TGACTCCTGTGCTCCTGCAGAGG - Intergenic
1200221728 X:154393741-154393763 TGACTCCTGTGCTCCTGCAGAGG + Intronic
1200673467 Y:6122709-6122731 TGAGGGCTGTGCCCCTGCAGTGG + Intergenic