ID: 1088817056

View in Genome Browser
Species Human (GRCh38)
Location 11:113428586-113428608
Sequence GTGGAGAACTTCCTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 1, 2: 5, 3: 78, 4: 472}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088817047_1088817056 30 Left 1088817047 11:113428533-113428555 CCACTACAGTTGATGTTCAGGAG 0: 1
1: 0
2: 1
3: 4
4: 90
Right 1088817056 11:113428586-113428608 GTGGAGAACTTCCTGGAGGAGGG 0: 1
1: 1
2: 5
3: 78
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088817056 Original CRISPR GTGGAGAACTTCCTGGAGGA GGG Intronic
900241220 1:1618477-1618499 GGTGAGGACTTCCTGGAGGCAGG - Intronic
900395827 1:2452884-2452906 GAGGAGGACAGCCTGGAGGAAGG + Intronic
900567517 1:3340919-3340941 CTGGAGTCCTCCCTGGAGGAAGG + Intronic
900608314 1:3533644-3533666 GTCGTGCACCTCCTGGAGGATGG - Intronic
900793332 1:4693362-4693384 ATGGAGGGCTTCCTGGAGGCAGG + Intronic
900893441 1:5466202-5466224 AAAGAGGACTTCCTGGAGGAGGG + Intergenic
901667021 1:10831823-10831845 GGGGAGGAGTTCCTGGTGGAAGG - Intergenic
901677888 1:10897517-10897539 ATGGAGGACTTCTTGGAGGAAGG - Intergenic
901716196 1:11156540-11156562 TTGCAGTACTTCCTGGAGGAAGG - Intronic
901834060 1:11912311-11912333 AGGGAGGTCTTCCTGGAGGAAGG - Intergenic
901971961 1:12915244-12915266 CTGGAGGACTTTCTGGAGGCGGG + Intronic
901989552 1:13101739-13101761 CTGGAGGACTTTCTGGAGGCAGG - Intergenic
901992260 1:13125013-13125035 CTGGAGGACTTTCTGGAGGCAGG + Intergenic
902013207 1:13286496-13286518 CTGGAGGACTTTCTGGAGGCGGG - Intergenic
902274665 1:15330888-15330910 GTGGACAACGTCCTGGAGGGTGG + Intronic
902757938 1:18561768-18561790 GTGGAGTAGTTCCTGGAGCCCGG - Intergenic
902797374 1:18808316-18808338 GAGAAGCTCTTCCTGGAGGAAGG + Intergenic
903265770 1:22157105-22157127 AGGGAAAGCTTCCTGGAGGAGGG - Intergenic
903294518 1:22335342-22335364 AGGGAGGACTTCCTGGAGGAAGG + Intergenic
903551646 1:24161428-24161450 AGGGAAGACTTCCTGGAGGAGGG + Intronic
904019455 1:27451349-27451371 GTTAAGAACTTCCAGGTGGAGGG + Intronic
904168970 1:28577863-28577885 GTGGATAACTACCTGGACAAAGG - Exonic
904460616 1:30677531-30677553 CAGGAAAATTTCCTGGAGGAAGG + Intergenic
904624889 1:31796851-31796873 GTGGAGGGCTTCCCAGAGGAGGG - Intronic
904917493 1:33980879-33980901 GTGGGGAACTTCCAGAAGGAGGG + Intronic
905052081 1:35060530-35060552 CAGGAGGAATTCCTGGAGGAAGG + Intronic
905117102 1:35651657-35651679 GGGGAGTAATTTCTGGAGGAAGG - Intergenic
906157059 1:43619977-43619999 AGTGAGGACTTCCTGGAGGAGGG + Intronic
906562201 1:46767371-46767393 TTAGAGGACTTCCTGGAGGAAGG + Intronic
907240480 1:53078354-53078376 CTGGAGAGCTTCCTGGGGCAGGG - Exonic
907307227 1:53520146-53520168 GAGGAAGACTTCCTGGAGGAGGG + Intronic
907322924 1:53616976-53616998 AGGGAAATCTTCCTGGAGGAGGG - Intronic
907480749 1:54744101-54744123 GTGTAGGACTTCCTGGAGAAGGG + Intergenic
913480863 1:119287999-119288021 GGGAAGGCCTTCCTGGAGGAAGG + Intergenic
915535506 1:156533222-156533244 TGGGAAAACTTCCTGGAAGAGGG - Intronic
915737008 1:158091370-158091392 AAGGAGAACTTCTTGGAGGTGGG + Exonic
917215413 1:172673087-172673109 CTTGAAAACTTCCTGGAGAAGGG + Intergenic
917434491 1:175005966-175005988 GTGAAAAACGTCATGGAGGATGG + Intronic
920089124 1:203440003-203440025 GTGGAGGCCTTCCTGGCAGAGGG + Intergenic
920686890 1:208116173-208116195 AAGGAAGACTTCCTGGAGGAGGG - Intronic
921936175 1:220799257-220799279 GTGGAGAACTTCCTAGTGTGAGG + Intronic
922004394 1:221514732-221514754 GTGGAGAAATTCCTTTAGGAAGG - Intergenic
923109282 1:230878374-230878396 CATGAGGACTTCCTGGAGGAGGG - Intergenic
923346983 1:233063740-233063762 GTCTAGAAGTTCCTGGAAGAAGG - Intronic
1062959613 10:1562648-1562670 TTGGAATACTTCCTGGAGGCTGG + Intronic
1063010878 10:2020424-2020446 TGGGTGAACTTCCTGAAGGACGG - Intergenic
1063153637 10:3358408-3358430 TTGCAGAACTTCCTGCAAGAAGG - Intergenic
1063454404 10:6173153-6173175 AGGGAGGGCTTCCTGGAGGAAGG - Intronic
1065813753 10:29465611-29465633 GTACAGATCTTCCTGCAGGAAGG + Exonic
1065957906 10:30709415-30709437 GTATAGATCTTCCTGCAGGAAGG - Intergenic
1067791429 10:49291204-49291226 TTAGAGAACTTCCTGGAACAGGG - Intergenic
1068497050 10:57796051-57796073 GTTGAGTGCTTCCTAGAGGAAGG - Intergenic
1070794919 10:79210861-79210883 ATGGAGGGCTTCCTGGAGGAGGG + Intronic
1071432807 10:85619514-85619536 TGGGAGAACTTCCCAGAGGAGGG - Intronic
1071839524 10:89454710-89454732 AGGGAAACCTTCCTGGAGGAAGG - Intronic
1072634065 10:97165941-97165963 GTGGGGAACTTTCTGGGGTAGGG - Intronic
1073402012 10:103265526-103265548 GTGGAGAACAGCCTTTAGGAGGG + Intergenic
1073435218 10:103512216-103512238 AGGGAGAACTTCCAGGAGAAGGG + Intronic
1073737094 10:106361283-106361305 GTGCTGGACTTGCTGGAGGAAGG - Intergenic
1074055787 10:109922414-109922436 GTGGAGAACTTCCATCTGGAAGG - Intronic
1074453943 10:113581277-113581299 AAGGAGGACTTCCTGGAGGAGGG - Intronic
1075508064 10:123043609-123043631 CTGGAGAACTCCCTGTAGGTGGG + Intronic
1075912178 10:126133995-126134017 CTGGAGCACTTCCTAGTGGAAGG - Intronic
1076148447 10:128143762-128143784 CTGGAATTCTTCCTGGAGGAGGG + Intergenic
1076773839 10:132682113-132682135 GTGGACAGCGTCCTGGAGGTGGG + Intronic
1076773846 10:132682139-132682161 GTGGACAGCGTCCTGGAGGTGGG + Intronic
1077123974 11:924499-924521 GCAGAGGGCTTCCTGGAGGACGG - Intergenic
1077283322 11:1755117-1755139 AGGGAGAGCTTCCTGAAGGAGGG + Intronic
1077773513 11:5246833-5246855 TTGGAGAAGTTCCTGAAAGAAGG + Intergenic
1078529609 11:12126859-12126881 CTGGAAAGCTTCCTGGAGGAGGG + Intronic
1078762027 11:14259369-14259391 GTGAAGCAGTTCCCGGAGGACGG + Exonic
1079123892 11:17705093-17705115 GAGGGGAAATTCCTGGAAGAAGG + Intergenic
1079747785 11:24155192-24155214 ATGGAGAGCTGCCTGGAGTATGG + Intergenic
1080258005 11:30314043-30314065 CTGGAGTGGTTCCTGGAGGAGGG - Intergenic
1080310992 11:30891943-30891965 TTGGAGAAGTTCATGGAGGCTGG - Intronic
1080913186 11:36626468-36626490 GTGTAGAACTTCCTGGTTGAAGG + Intronic
1081567340 11:44268202-44268224 AGGGAAGACTTCCTGGAGGAGGG + Intronic
1082160003 11:48880324-48880346 GTGGAGAGCGTACTGGAGGAGGG + Intergenic
1082162774 11:48901946-48901968 TTGGAGAGCGTCCTGGAGGAGGG - Intergenic
1082175173 11:49049924-49049946 GTGGAGAGCGTACCGGAGGAGGG - Intergenic
1082238643 11:49850788-49850810 GTGGAGAGCGTCCTGGAGAAGGG + Intergenic
1082243498 11:49893524-49893546 GAGGAGGGCGTCCTGGAGGAGGG - Intergenic
1082243503 11:49893539-49893561 GTGGAGAGCGTCCTGGAGGAGGG - Intergenic
1082657990 11:55874350-55874372 GTGGAGAACGTCCTGGAGGAGGG - Intergenic
1083335889 11:61921510-61921532 GGGGAGGGCTTCCTAGAGGAGGG - Intergenic
1083737686 11:64690967-64690989 CTGGAGAAGTTTCTGGAGGAGGG - Intronic
1083894088 11:65611572-65611594 GTGGAGGACTTGCGGGAGGAAGG - Intronic
1084474841 11:69382928-69382950 CTGGAAGACTTCCTGGAGGAGGG - Intergenic
1084484414 11:69439440-69439462 CTGGAAGACTTCCTGGAGGAGGG - Intergenic
1084678233 11:70649315-70649337 GTAGAGAACTTGCTGGTGGGTGG + Intronic
1085123198 11:73980540-73980562 GTGGAGCACCTCCTGGGGGAAGG - Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085391446 11:76184343-76184365 GGGGAGGGCTTCCTGGAGGAGGG + Intergenic
1085482247 11:76832486-76832508 AGGGAGCACTTTCTGGAGGAGGG - Intergenic
1085757413 11:79213163-79213185 GTGGGGACATTCCAGGAGGAAGG + Intronic
1085838286 11:79980078-79980100 GAAGAAAACTTTCTGGAGGAAGG + Intergenic
1085872648 11:80368690-80368712 GTGCAGAGCTTCCTAGATGATGG + Intergenic
1086348103 11:85918459-85918481 ATGGGAGACTTCCTGGAGGAAGG + Intronic
1086690594 11:89786160-89786182 GTGGAGAGCGTACCGGAGGAGGG + Intergenic
1086697923 11:89865347-89865369 GAGGAGGGCGTCCTGGAGGAGGG - Intergenic
1086697928 11:89865362-89865384 GTGGAGAGCGTCCTGGAGGAGGG - Intergenic
1086708234 11:89979126-89979148 GTGGAGAGCGTCCTGGAGGAGGG + Intergenic
1086708239 11:89979141-89979163 GAGGAGGGCGTCCTGGAGGAGGG + Intergenic
1086715205 11:90053500-90053522 GTGGAGAGCGTACCGGAGGAGGG - Intergenic
1086891056 11:92258720-92258742 GTGGAGAGTTACCTGGAGGCAGG + Intergenic
1088763299 11:112952244-112952266 GTGGAGAACATCTTGTAGGGAGG - Intergenic
1088817056 11:113428586-113428608 GTGGAGAACTTCCTGGAGGAGGG + Intronic
1089097829 11:115934233-115934255 GGGGAGAACTGGCAGGAGGAAGG - Intergenic
1091871209 12:3892681-3892703 GTAGACAATTTCCTGAAGGAAGG - Intergenic
1092889336 12:12954043-12954065 GTGGAGAACCTCCTGGGTGATGG + Intergenic
1095249049 12:39957561-39957583 ATGGAGAACTCCCTGGATGTGGG - Intronic
1095497424 12:42799534-42799556 ATGGAGAAGTGACTGGAGGAAGG - Intergenic
1096521456 12:52186962-52186984 ATGGAGGGCTTCCTGCAGGAGGG - Intronic
1096575393 12:52549493-52549515 GGGGAAGGCTTCCTGGAGGAGGG + Intronic
1096593953 12:52682299-52682321 GAGGGGCACTTTCTGGAGGAGGG - Intergenic
1096679700 12:53247421-53247443 GTGGAGGTCATCCTGGATGAAGG - Intergenic
1096800197 12:54105578-54105600 AAGGAGTACTTCCTGGAGGAGGG - Intergenic
1097624879 12:61988038-61988060 GTGGATAACAGCCAGGAGGAAGG + Intronic
1099598050 12:84693890-84693912 GTATAGAAGTTCCAGGAGGAAGG + Intergenic
1100672161 12:96825125-96825147 ATGGAAGACTTCCTGGAGGAAGG - Intronic
1100855051 12:98750763-98750785 GGGAAGAAATTCCTGGAGGAAGG + Intronic
1102007325 12:109597012-109597034 GGGGAAGGCTTCCTGGAGGAGGG - Exonic
1103021724 12:117539823-117539845 GTGGAGGACGTCGTGGAGGAGGG + Exonic
1103365550 12:120380152-120380174 GGAGATAACTTTCTGGAGGAAGG - Intergenic
1103982727 12:124746951-124746973 TTGGAGGACTTCCTGGAGGAGGG + Intergenic
1104558075 12:129820102-129820124 ATGGAGAACTTCCATGCGGAAGG - Intronic
1104687032 12:130793203-130793225 GGGGAGAGCTGCCTGCAGGAGGG + Intronic
1104747926 12:131221607-131221629 CTGGAGGGCTTCCTGCAGGAGGG - Intergenic
1106099518 13:26682344-26682366 GTGCAGCACTTCCTGAAGAAAGG - Intronic
1106413593 13:29527763-29527785 GTGGTGAACTTCCTGCAGCAGGG + Intronic
1107053756 13:36080542-36080564 ATGGAGCACTACCTGGAGCAAGG - Intronic
1108372053 13:49779924-49779946 GAGGAGAGTTTCCTGAAGGAGGG - Intronic
1110088220 13:71409394-71409416 GTAAAGAACTTCCCAGAGGAGGG - Intergenic
1110362845 13:74647021-74647043 GTGGAGAACTTCCAGCAAGAAGG + Intergenic
1110401430 13:75096123-75096145 GTGGAGAACAACCTGGTAGAAGG + Intergenic
1110488402 13:76073110-76073132 ATGTAGAATTTCCTGGAGGGTGG + Intergenic
1113060948 13:106322254-106322276 GTTCAGAACTTCCTGGAGACTGG + Intergenic
1113589681 13:111489519-111489541 GTGGAGAAGGTCCTGGAAGTTGG + Intergenic
1117061365 14:51966891-51966913 CTGACGAACTGCCTGGAGGAGGG + Exonic
1119416361 14:74472688-74472710 AGGGAGGGCTTCCTGGAGGAAGG + Intergenic
1119558585 14:75572060-75572082 GGGGAAGGCTTCCTGGAGGAGGG + Intergenic
1120588963 14:86352223-86352245 GTAAAGAATTTCATGGAGGATGG + Intergenic
1121013442 14:90534842-90534864 GTGGAGAACTCCAAGGATGATGG + Exonic
1121017529 14:90557566-90557588 AGGGAGGGCTTCCTGGAGGAGGG + Intronic
1121488912 14:94343879-94343901 GTGTGGCACCTCCTGGAGGAAGG - Intergenic
1121717507 14:96086850-96086872 GGGGAGAAATTCCAGAAGGACGG - Exonic
1122126433 14:99581058-99581080 GAGGAGACCATCCTGGAGGCAGG + Intronic
1122266039 14:100547328-100547350 CTGGAAGGCTTCCTGGAGGAAGG - Intronic
1122292771 14:100688426-100688448 GAGGAGAAGTTCCGGGAGGGAGG - Intergenic
1122856103 14:104560994-104561016 GGGGAGACCTGCCTGGTGGAGGG - Intronic
1123054291 14:105561870-105561892 GTGGAGGCTTTCCTGGGGGAGGG - Intergenic
1123078875 14:105682289-105682311 GTGGAGGCTTTCCTGGGGGAGGG - Intergenic
1123143741 14:106108363-106108385 TTGGAGAACAGCCAGGAGGAGGG + Intergenic
1123191841 14:106579133-106579155 TTGGAGAACAGCCAGGAGGAGGG + Intergenic
1202902674 14_GL000194v1_random:52484-52506 AGGGAAGACTTCCTGGAGGAGGG - Intergenic
1123754559 15:23386827-23386849 GTGGACACCTTCCTGATGGAAGG - Intergenic
1124439788 15:29677663-29677685 CTGGAGGGCTTCGTGGAGGAAGG + Intergenic
1127463725 15:59224109-59224131 ATGTAGAACTTTCTGGAGGTAGG - Intronic
1128801167 15:70498044-70498066 TCAGAGAACTTCCTGGGGGAAGG - Intergenic
1129198002 15:73982506-73982528 GTGGAGGACCTCCAGGAGGCGGG + Exonic
1129697997 15:77751564-77751586 CTGGAGGGCTTCCTGGAGAAGGG + Intronic
1130838125 15:87671853-87671875 CTTGAGAACTTCCTGGAGAAGGG - Intergenic
1130905415 15:88236891-88236913 GTGGGGAACTTTCTGGGGGATGG + Intronic
1130982178 15:88820329-88820351 ATGGGGGACTTCATGGAGGAAGG + Intronic
1131597214 15:93810628-93810650 GAGAAGAACTTCATAGAGGAAGG - Intergenic
1132110713 15:99100169-99100191 GGGGAGAAAATCCTGAAGGAAGG - Intronic
1132202561 15:99964917-99964939 GTGGAGAAGTTCCAGCAGAACGG + Intergenic
1132423589 15:101695228-101695250 GGAGGGAACTTCCTGGAGGGTGG - Intronic
1132670401 16:1100143-1100165 AGGGAGGGCTTCCTGGAGGAGGG - Intergenic
1132723477 16:1328133-1328155 GCGGAGGGCATCCTGGAGGAAGG - Intergenic
1132997339 16:2830176-2830198 GTGGGGCTCTTCCTGGGGGAAGG - Exonic
1134062166 16:11205847-11205869 GTGTAGAACTTCCTGCCGCAAGG - Intergenic
1134098288 16:11434097-11434119 CGGGAGGGCTTCCTGGAGGAGGG - Intronic
1134461811 16:14436162-14436184 GTGGACATCTTCCTGAAGGAAGG + Exonic
1135134463 16:19877341-19877363 ACGGAGGACTTCCTGGAAGAAGG - Intronic
1135420415 16:22302100-22302122 GAGGAGAAATTCCAGGAAGAGGG - Intronic
1135590765 16:23703814-23703836 ATGGAAAGCTTCCTAGAGGAAGG - Intronic
1136019513 16:27431042-27431064 CTGGAGGGCTTCCTGGAGGAGGG + Intronic
1136074272 16:27806149-27806171 TTGGAGGGCTTCCTGGAAGAGGG - Intronic
1137555730 16:49469191-49469213 AGGGAGGACTTCCTGGAGAAGGG - Intergenic
1139363328 16:66417186-66417208 CTGGAGGCCTTCCTGTAGGATGG - Intergenic
1139372386 16:66477184-66477206 AGGGAGGGCTTCCTGGAGGAGGG - Intronic
1140118729 16:72065257-72065279 GTGAAGAACCTCCAGGAGGTGGG + Intronic
1140970582 16:80008668-80008690 GCTGAGAACTTCCAGGTGGAAGG - Intergenic
1141168623 16:81677179-81677201 AAGGAAGACTTCCTGGAGGAGGG + Intronic
1142151575 16:88514735-88514757 AGGGAGGACTTCCTGGAGGAGGG + Intronic
1142642523 17:1292708-1292730 AGGGAAGACTTCCTGGAGGAAGG - Intronic
1142671149 17:1487989-1488011 GTGGGGAACGTCCTAGAAGACGG + Intronic
1142737638 17:1911367-1911389 GTGCAGGAGTCCCTGGAGGAGGG - Intergenic
1144003049 17:11073378-11073400 GAGGAAGGCTTCCTGGAGGAGGG - Intergenic
1144295345 17:13870011-13870033 GTGGAGCAGTCCCTGGAGGAGGG - Intergenic
1144802085 17:17936309-17936331 GGGGAAAACTTCCTGGAAGAAGG - Intronic
1144942802 17:18952969-18952991 GTGGAGGCCTTCCTGAGGGAAGG + Intronic
1144943086 17:18954675-18954697 GAAGAGATGTTCCTGGAGGAGGG + Intronic
1145058492 17:19718049-19718071 GTGGAGAAGGTGTTGGAGGAGGG - Intronic
1146158352 17:30543609-30543631 TTGAAGAACTTCCTCGAGGCAGG - Intergenic
1146475904 17:33162600-33162622 GAGGAGAAGTGGCTGGAGGAGGG - Intronic
1146587475 17:34094694-34094716 GTGGAGAAATTCCTGTGAGATGG - Intronic
1146599385 17:34201423-34201445 AGGGAGGACTTCCTGTAGGAGGG + Intergenic
1147449824 17:40497202-40497224 AGGGAGGTCTTCCTGGAGGAAGG + Intronic
1147572485 17:41579949-41579971 GTGGGGAAATCCCGGGAGGAGGG + Intergenic
1147917542 17:43897751-43897773 GAGGAGGGCTTCCTGGAGGAAGG - Intronic
1148093322 17:45035604-45035626 GAGGCCAACTTCCTAGAGGAAGG + Intronic
1148350086 17:46935075-46935097 GTTGTGAACTTTCTGGAGGGAGG - Exonic
1148683829 17:49489743-49489765 GCGAGGAACTTCCTAGAGGAAGG + Intergenic
1149503273 17:57171379-57171401 GGAGAGAAAGTCCTGGAGGAAGG + Intergenic
1149640031 17:58196819-58196841 AAGGAGGGCTTCCTGGAGGAAGG + Intronic
1149698731 17:58637594-58637616 ATGGAGAGGTTCCTGGAGGATGG + Intronic
1150218536 17:63483326-63483348 GGGGAAGACTTCCTGGAAGAGGG - Intergenic
1151258797 17:72900605-72900627 GTGGAGACCTTACTGCAAGAGGG + Intronic
1151696844 17:75722198-75722220 CTGTAGAGCTTCCTGAAGGAAGG - Intronic
1151956332 17:77381915-77381937 CGGGAGGGCTTCCTGGAGGAAGG + Intronic
1152124305 17:78437264-78437286 GTGGGGTACTCCCTGGAGGCTGG - Intronic
1153910432 18:9701890-9701912 GGGAAGAACTGTCTGGAGGAAGG + Intergenic
1155214832 18:23634076-23634098 GTGGAGACCTTGCTGAAGCACGG - Exonic
1155233201 18:23794077-23794099 GTGGGGAGGTTCCTGGAGGGTGG - Intronic
1155337796 18:24783202-24783224 GTGGAGATCTGGCAGGAGGAGGG - Intergenic
1156365489 18:36422487-36422509 GAGGATAAATTCCTGGAGGTGGG + Intronic
1156891037 18:42189494-42189516 ATGGAGCAGATCCTGGAGGAAGG + Intergenic
1157182205 18:45507704-45507726 GCGGACATCTTCCTGGAAGAAGG + Intronic
1159070218 18:63614422-63614444 GTGAAAGACTTCCTGGAAGAGGG + Intergenic
1159087376 18:63809322-63809344 TGGGAAGACTTCCTGGAGGAAGG + Intergenic
1159107438 18:64019211-64019233 TTGGAGAACTGACTGGATGATGG - Intergenic
1159467526 18:68803993-68804015 GTGGAGAACATACTGGAGTAGGG + Intronic
1160881809 19:1324398-1324420 CAGGAGGGCTTCCTGGAGGAGGG + Intergenic
1160953759 19:1680031-1680053 AGGGAGGGCTTCCTGGAGGAGGG + Intergenic
1161422504 19:4183578-4183600 CGGGAGGGCTTCCTGGAGGAGGG + Intronic
1161469331 19:4448405-4448427 GTGGAGAAGTGCTGGGAGGAGGG + Exonic
1161489100 19:4552167-4552189 AGGGAGGGCTTCCTGGAGGAGGG - Intronic
1161574461 19:5048011-5048033 GTGGAGACGTTCCTGGTGAAGGG + Intronic
1161741975 19:6026894-6026916 CAGCAGAACTTCCTGGAGGAAGG + Intronic
1161847728 19:6721237-6721259 AGGGAAAACTTCCTGTAGGAGGG + Intronic
1162069349 19:8144484-8144506 AGGGAGGGCTTCCTGGAGGAGGG - Intronic
1162180240 19:8863802-8863824 AAGGAGGGCTTCCTGGAGGAGGG - Intronic
1162183072 19:8883766-8883788 GTGTTGAACTTCCTGGAGCCAGG + Exonic
1162183496 19:8886761-8886783 GTGTTGAACTTCCTGGAGCCAGG + Exonic
1162184345 19:8892915-8892937 GTGTTGAACTTCCTGGAGCCAGG + Exonic
1162185159 19:8898937-8898959 GTGTTGAACTTCCTGGAGCCAGG + Exonic
1162185585 19:8902123-8902145 GTGTTGAACTTCCTGGAGCCTGG + Exonic
1162185963 19:8904970-8904992 GTGTTGAACTTCCTGGAGCCAGG + Exonic
1162186346 19:8907786-8907808 GTGTTGAACTTCCTGGAGCCAGG + Exonic
1162186685 19:8910403-8910425 GTGTTGAACTTCCTGGAGCCAGG + Exonic
1162530999 19:11236528-11236550 CTGGTGCACGTCCTGGAGGAGGG - Exonic
1162580442 19:11526679-11526701 GGGGAGAACTGACTGGAGGCAGG - Intronic
1163254011 19:16143893-16143915 GGGGAGAGCTTCGTGGAGGAGGG + Intronic
1163273285 19:16266959-16266981 TGGGAAGACTTCCTGGAGGAAGG + Intergenic
1163394137 19:17049207-17049229 GTGGTGGACGTCCTGGAGGGCGG + Intergenic
1163434717 19:17288656-17288678 GGCGAGAACTTGCTGGAGGAAGG + Intergenic
1163437055 19:17302221-17302243 GTGGGGATGTTCCTGGAGAAGGG + Intronic
1163444113 19:17336891-17336913 CAGGAAGACTTCCTGGAGGAGGG + Intronic
1163464687 19:17460509-17460531 AGGGAGGGCTTCCTGGAGGAGGG - Intronic
1163481683 19:17560244-17560266 AGAGAGAGCTTCCTGGAGGAGGG - Intronic
1163512102 19:17741506-17741528 AAGGAGGACTTCCTGGAGGAGGG + Intergenic
1163512123 19:17741580-17741602 AAGGAGGGCTTCCTGGAGGAGGG + Intergenic
1163512141 19:17741645-17741667 ATGGAGGGCTTCCTGGAGGAAGG + Intergenic
1163512159 19:17741710-17741732 ATGGAGGGCTTCCTGGAGGAGGG + Intergenic
1163572539 19:18090886-18090908 AGGGAGGACTGCCTGGAGGAGGG + Intronic
1163581900 19:18144262-18144284 GAGGAAGGCTTCCTGGAGGAGGG + Intronic
1164518074 19:28953437-28953459 CTGAAGAACTGCCTGGTGGATGG + Intergenic
1165140940 19:33699449-33699471 CAGGAGGACTTCCTGGAAGAGGG + Intronic
1165303627 19:34989482-34989504 GTGGGGAATTTCCTTGAGGTGGG + Intergenic
1165431759 19:35776891-35776913 AGGGAGAACTTCCTGGAGGAGGG + Intronic
1165461820 19:35948437-35948459 GAGGAAGGCTTCCTGGAGGAGGG + Intergenic
1165739217 19:38195731-38195753 AGGGAGGGCTTCCTGGAGGAGGG - Intronic
1165762232 19:38328143-38328165 AGGGAGGACTTCCTAGAGGAAGG + Exonic
1165923085 19:39310826-39310848 TGGGAGAACCTCCTGGAGGTGGG - Intronic
1166190400 19:41172982-41173004 AGGGAGGGCTTCCTGGAGGAGGG - Intergenic
1166217349 19:41344353-41344375 AGGGAGGGCTTCCTGGAGGAGGG - Intronic
1166287204 19:41838497-41838519 GTGGACAGATCCCTGGAGGAGGG - Intronic
1166319193 19:42006017-42006039 GAGGGAGACTTCCTGGAGGATGG - Intronic
1166339774 19:42130774-42130796 AAGGAGGGCTTCCTGGAGGAAGG - Intronic
1166557849 19:43713397-43713419 AGGGAGGGCTTCCTGGAGGAGGG - Intergenic
1166645801 19:44530776-44530798 AGGGAGAGCTTCCTGGAAGAGGG + Intergenic
1166673051 19:44722931-44722953 AAGGAGGGCTTCCTGGAGGAAGG + Intergenic
1166760080 19:45218601-45218623 ATGGAGGGCTTCCTGGAGGAGGG + Intronic
1166804394 19:45476580-45476602 GGGAAAAACTTCCTGGCGGAGGG + Intronic
1166818189 19:45559764-45559786 AGGGAGGGCTTCCTGGAGGAAGG - Intronic
1166876386 19:45900422-45900444 CAGGAGGGCTTCCTGGAGGAGGG - Intronic
1167007046 19:46782812-46782834 AGGGGGGACTTCCTGGAGGAAGG + Intronic
1167015751 19:46839840-46839862 CAGGAGGGCTTCCTGGAGGAGGG + Intronic
1167096238 19:47376333-47376355 AGGGAGGGCTTCCTGGAGGAGGG + Intronic
1167153388 19:47723056-47723078 AAGGAGGACTTCCAGGAGGAGGG - Intronic
1167646790 19:50710359-50710381 TTGGAAGACTTCCTGGAGGAAGG + Intronic
1167744469 19:51342433-51342455 CAGGAAGACTTCCTGGAGGAGGG + Intergenic
1168434219 19:56304571-56304593 GAGGAGAACTGGCTGGAAGATGG + Intronic
925051479 2:819159-819181 GTGAGGACCTTCCTGGGGGATGG - Intergenic
926234401 2:11028474-11028496 GTGGAGCCCCTCCAGGAGGAAGG - Intergenic
926811375 2:16757902-16757924 AGGGAAAACTTCCTGGAGGAAGG - Intergenic
927203995 2:20595491-20595513 CAGGAGGGCTTCCTGGAGGAGGG + Intronic
927874074 2:26642729-26642751 GTGCAGACCCTCCTGGAGGCAGG - Intergenic
927997677 2:27497355-27497377 GCTGAGATCTTCCAGGAGGAGGG + Exonic
928086110 2:28347419-28347441 CTGGAGGGCTTCCTGGAGGAGGG + Intergenic
928110580 2:28505702-28505724 TGGGAAAACTTCCTGCAGGAAGG - Intronic
928951904 2:36820691-36820713 ATGAAGACCATCCTGGAGGAGGG - Intergenic
929010897 2:37443175-37443197 GTGGGAAATTTCCTGGATGATGG + Intergenic
930912131 2:56641698-56641720 CTGGAGAACTTATTGGAGAAAGG + Intergenic
933286972 2:80395193-80395215 TTGGAGAGCTTCCTGTAAGATGG + Intronic
933702057 2:85262771-85262793 CTGGAGAACTTATTGGAGGATGG - Intronic
934503988 2:94877910-94877932 AGGGAGGGCTTCCTGGAGGAGGG + Intergenic
934588305 2:95525544-95525566 TTGGAGAGCGTCCCGGAGGAGGG + Intergenic
935700752 2:105809803-105809825 CAGGAGGTCTTCCTGGAGGAGGG + Intronic
936007620 2:108905275-108905297 GAGAAGAGCTTCCTGGTGGATGG + Intronic
936014298 2:108946114-108946136 GTGGACGACTGCCAGGAGGAGGG - Intronic
936175335 2:110214800-110214822 ATGTGGAAGTTCCTGGAGGATGG - Intergenic
937251012 2:120523811-120523833 GAGTAGATCTTCCTGGAGTAGGG + Intergenic
939040315 2:137181273-137181295 GTAGAGATATTCCTAGAGGAGGG + Intronic
940011483 2:149059791-149059813 GTAGAGAACTTTCTGGAGCCTGG + Intronic
944343803 2:198636187-198636209 CTGGAGAACTTCCTGTGGAAAGG - Intergenic
945120098 2:206448749-206448771 ATGTGGAACTTCCTGGAGGGTGG + Intronic
946117223 2:217473643-217473665 CTTGAGAACTTCCAGGAGCAGGG + Intronic
946307398 2:218864114-218864136 GTAAAGAACTTCCTGGGGGTGGG - Intronic
946909108 2:224442747-224442769 CCGGAAAGCTTCCTGGAGGAGGG + Intergenic
948398972 2:237668631-237668653 AGGGAGGGCTTCCTGGAGGAGGG - Intronic
1169745511 20:8938626-8938648 GTGGAGTACTTACTAGAGGAAGG + Intronic
1169786466 20:9364476-9364498 GTGGACTTCCTCCTGGAGGAGGG - Intronic
1171014226 20:21525206-21525228 GCGGGGAGCTTCGTGGAGGAAGG - Intergenic
1171796253 20:29568763-29568785 AAGGAGTACTTCCTGGAGGAGGG + Intergenic
1171851984 20:30315404-30315426 AAGGAGTACTTCCTGGAGGAGGG - Intergenic
1171943039 20:31349361-31349383 GTGGTGAACTGCCTGGAGCTGGG - Intergenic
1172029938 20:31974891-31974913 GTGGAGAGCCTCCTGGAGAGGGG - Intronic
1172194687 20:33083793-33083815 ATGGAGGACTTCTTGGAGGAGGG + Exonic
1173857463 20:46259647-46259669 ATGGAGGGCTGCCTGGAGGAGGG + Intronic
1174282718 20:49450997-49451019 CGAGAGAACTTCCTGGATGATGG - Intronic
1174421889 20:50404674-50404696 AAGGAGGGCTTCCTGGAGGAAGG - Intergenic
1174431530 20:50473412-50473434 TTGGAGAAACTACTGGAGGAAGG + Intergenic
1175940711 20:62536359-62536381 CAGGAGGGCTTCCTGGAGGAAGG - Intergenic
1175951199 20:62584295-62584317 AGGGAGGACTTCCTGGAGGAAGG + Intergenic
1175979116 20:62728136-62728158 AGGGAGGGCTTCCTGGAGGAGGG + Intronic
1176144706 20:63560375-63560397 AGGGAGGGCTTCCTGGAGGAGGG - Intronic
1176190095 20:63804448-63804470 CGGGAGGGCTTCCTGGAGGAGGG - Intronic
1176342680 21:5713333-5713355 GATGACAACTTCCTAGAGGAAGG - Intergenic
1176474934 21:7145484-7145506 GATGACAACTTCCTAGAGGAAGG - Intergenic
1176502147 21:7611123-7611145 GATGACAACTTCCTAGAGGAAGG + Intergenic
1176537001 21:8111402-8111424 GATGACAACTTCCTAGAGGAAGG - Intergenic
1176622038 21:9067251-9067273 AGGGAAGACTTCCTGGAGGAGGG - Intergenic
1176963544 21:15186982-15187004 GTGCAGAACTACTTGGGGGAGGG - Intergenic
1177808800 21:25902663-25902685 GTAGAGAACTTACTGGAGATGGG - Intronic
1179712985 21:43273693-43273715 TTGGAGAACTTCCTGAGGGCCGG + Intergenic
1179900561 21:44391329-44391351 GTGAAGCTCTTCCTGGAGAACGG + Exonic
1180632662 22:17240541-17240563 ATGGATATCTTCCTTGAGGATGG + Intergenic
1181092280 22:20482060-20482082 ATGGTGACCTTCCTGGAGCAGGG - Intronic
1181954911 22:26581216-26581238 AGGGAAGACTTCCTGGAGGAAGG - Intronic
1181957348 22:26597588-26597610 ATGGATATCTTCCTGGAGGAGGG - Intergenic
1182004149 22:26945011-26945033 CTGGAGAACGTCCTGGATAAAGG + Intergenic
1182354558 22:29716724-29716746 GGGGAGAAGGTACTGGAGGAGGG - Intergenic
1182873659 22:33671204-33671226 GTGGTGTACTTCCTGCAGCAGGG - Intronic
1182991901 22:34776240-34776262 CAAGAGGACTTCCTGGAGGAGGG + Intergenic
1183023280 22:35044307-35044329 AGGGAAGACTTCCTGGAGGAAGG - Intergenic
1183390934 22:37545543-37545565 AGGGAGGGCTTCCTGGAGGAAGG - Intergenic
1184057391 22:42061508-42061530 CTGGAAAACCTTCTGGAGGATGG - Intronic
1184334744 22:43846528-43846550 AAGGAAGACTTCCTGGAGGAGGG + Intronic
1184425493 22:44406840-44406862 GTGGAGGGCATCCTGGAAGAGGG - Intergenic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
1184595065 22:45509007-45509029 AGGGAGGACTTCCTGGAGGAAGG + Intronic
1184644086 22:45886664-45886686 AGGGAGGGCTTCCTGGAGGAGGG - Intergenic
1184692813 22:46124902-46124924 ATGGAGAACTTCCTGGGGCACGG + Intergenic
1184718348 22:46294869-46294891 GTAGAAGGCTTCCTGGAGGAGGG - Intergenic
1184889979 22:47373685-47373707 GCTGGGAGCTTCCTGGAGGAGGG + Intergenic
1203241952 22_KI270733v1_random:27806-27828 GATGACAACTTCCTAGAGGAAGG - Intergenic
950017886 3:9767155-9767177 GGGGAAAACTTCCTGGAGAATGG - Intronic
950071308 3:10155021-10155043 GTGTAGAGGTTCCTGGAGGGTGG + Intergenic
950100439 3:10353325-10353347 AAGGAGGACTTCCTGGGGGAGGG + Intronic
950575109 3:13827621-13827643 GGGGTGAACTTCCTGGAAGAAGG + Intronic
952236038 3:31481220-31481242 GTGGCTCTCTTCCTGGAGGAAGG - Intergenic
952337832 3:32420431-32420453 GTGGGGAACTTTCTGAAGGGAGG + Intronic
952392203 3:32890456-32890478 GTGCAGCAGGTCCTGGAGGAGGG + Exonic
952887489 3:38020528-38020550 AGGGATGACTTCCTGGAGGAGGG - Intronic
953237879 3:41121830-41121852 GTGGAGGACTACTGGGAGGAGGG + Intergenic
953378262 3:42446968-42446990 GTGGGGAAGTTCGTGGAGAAAGG - Intergenic
954109477 3:48426168-48426190 GTGGAGTGTGTCCTGGAGGAAGG + Intronic
954430234 3:50466941-50466963 CTGGAGGGATTCCTGGAGGAGGG + Intronic
954469241 3:50677630-50677652 TTGGAGAAATTTGTGGAGGAGGG + Intronic
954855779 3:53642458-53642480 ATGGAGCAGTTCCTGGGGGAAGG + Intronic
955125070 3:56103094-56103116 AGAGAGAGCTTCCTGGAGGAAGG + Intronic
955166081 3:56512553-56512575 GTAGAAAACTTCCTGTAAGAGGG - Intergenic
955604995 3:60692087-60692109 GTGGAAAACCTGCTAGAGGATGG - Intronic
955873037 3:63460064-63460086 GTGGAGAATAGCTTGGAGGAAGG - Intronic
958085490 3:88800590-88800612 GTGGAGAATTTACTGAAGAAGGG - Intergenic
960456118 3:117874417-117874439 GTGGAGAACAGCTTGGGGGAGGG - Intergenic
961110283 3:124277694-124277716 GTGGAGAACAGAATGGAGGAAGG + Intronic
961413815 3:126742998-126743020 GTGGAGAGGTGCCTGGGGGAGGG + Intronic
961810144 3:129517483-129517505 GTTGAGTTCTACCTGGAGGAAGG + Exonic
961825761 3:129598263-129598285 CGGGAGGGCTTCCTGGAGGAGGG - Intronic
963094400 3:141520375-141520397 GTGGTGTACCTGCTGGAGGAGGG + Intronic
963942184 3:151106146-151106168 GTGGACAACTGACTGGAGTAGGG - Intronic
965887500 3:173465309-173465331 GCTGAGAACTTCTTGGAGGAAGG + Intronic
966278121 3:178199807-178199829 GTGAAGAACTTCCTGGGGTATGG - Intergenic
967060249 3:185865947-185865969 GTGTAGAGTTTCCAGGAGGAGGG + Intergenic
968514492 4:1010534-1010556 TGGGAGGACTTCCTGGAAGAGGG + Intronic
968655825 4:1778063-1778085 CAGGAGGACTTCCTGGAAGAGGG + Intergenic
969176497 4:5402856-5402878 CAGGAGGGCTTCCTGGAGGAAGG + Intronic
969305958 4:6326454-6326476 AAGGAGAACTTCATGGAGGAGGG + Intronic
969636906 4:8374596-8374618 CTGGAAGGCTTCCTGGAGGAGGG - Intronic
969671845 4:8594013-8594035 CAGGAGAGCTTCCTGGAGGAGGG - Intronic
969859639 4:10025512-10025534 GCTGAGGACTTCCTGGAGGAAGG + Intronic
970456521 4:16227918-16227940 ATAGAGAATTTCATGGAGGATGG - Intergenic
970732559 4:19123953-19123975 GTGGAGAATGTCCTGTAGGCTGG + Intergenic
971478364 4:27092716-27092738 GACTAGAACTTCTTGGAGGATGG - Intergenic
973618544 4:52704814-52704836 GGGGAATACTTGCTGGAGGAAGG - Intergenic
978271170 4:106892876-106892898 ATGGAGAGCTTCCTGGAGTCTGG + Intergenic
979505309 4:121488487-121488509 GAGTAGAACTTCCTGGAAAAAGG + Intergenic
980675475 4:136073580-136073602 CTGGAGAACATCCTGTATGATGG + Intergenic
981004405 4:139860340-139860362 ATGGAGAACTTTCTGGAAGATGG - Intronic
981237299 4:142434357-142434379 GAGGAGAACTCACTGGTGGATGG + Intronic
981491684 4:145346618-145346640 ATGGAGAACTTTCTGGAAGATGG - Intergenic
982039934 4:151387174-151387196 CTGGAGAACTTCCTTGAAAAGGG - Intergenic
983017345 4:162629122-162629144 GTGCAGAACTGCCTGGAGCTGGG - Intergenic
983844969 4:172506694-172506716 ATGGAGAACTGACTGGAGAAAGG - Intronic
984571475 4:181399592-181399614 GGGGAGGACTTCATGGAAGAAGG + Intergenic
984794561 4:183646509-183646531 AAGGAGAACTTCCTCGAGGCTGG - Exonic
984975717 4:185228402-185228424 GGAGAGAACTTCGTGGAGGTTGG + Intronic
985661502 5:1159348-1159370 GTGGAGAACTTACGGGAGCCAGG - Intergenic
989141423 5:38205288-38205310 GTGGATAACTTGCTGTAAGAAGG + Intergenic
989691149 5:44145742-44145764 TAGTTGAACTTCCTGGAGGAGGG + Intergenic
991939847 5:71839914-71839936 GAGGAGAAGTTCAAGGAGGATGG + Intergenic
992102055 5:73417586-73417608 GACGAGGAATTCCTGGAGGAGGG + Intergenic
992833908 5:80621656-80621678 GTGGAGTACTTGGTGGAGGTGGG + Intergenic
993488823 5:88521096-88521118 CAGGAGAACTGACTGGAGGAAGG + Intergenic
993509898 5:88758110-88758132 GAGGAGAAGTGCTTGGAGGAAGG - Intronic
994730410 5:103484632-103484654 GAGGAGGAGGTCCTGGAGGAGGG + Intergenic
995463803 5:112430120-112430142 TGGGAGAGCTTCTTGGAGGAGGG - Intergenic
997226653 5:132214189-132214211 AGGGACAACTTCCTGGTGGAAGG - Intronic
997234989 5:132267561-132267583 AAGGAGTGCTTCCTGGAGGAAGG + Intronic
997469493 5:134108932-134108954 AGGGAGGGCTTCCTGGAGGAAGG - Intergenic
998011631 5:138699886-138699908 GTGGAGAACAGCCAGGAGAAAGG + Intronic
998171444 5:139874117-139874139 GTGGAAATCTCCCTGGAGTATGG - Intronic
999125007 5:149240112-149240134 GTGGTGAACTTCCAGGAGAGGGG + Intronic
999326986 5:150649821-150649843 GTGGGGTATTTCCAGGAGGAAGG - Exonic
999442511 5:151613465-151613487 GCGGAGAACCTCATGGAGCAAGG - Intergenic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1001853931 5:174994552-174994574 ACGGAGGGCTTCCTGGAGGAGGG + Intergenic
1002081760 5:176741611-176741633 CTGCAGAGCTTCCTGGTGGATGG - Intergenic
1002294318 5:178221723-178221745 GTGGAGAAAGAACTGGAGGAAGG - Intronic
1002613033 5:180433764-180433786 CTGGAGAAACGCCTGGAGGAAGG - Intergenic
1005298795 6:24451113-24451135 GTGCAGAAAGTCCTGTAGGACGG + Intronic
1005630536 6:27703262-27703284 CTGGAGAACTTTGTGGAGAAGGG - Intergenic
1007003373 6:38336030-38336052 ATAGAGAACTACCTGGAGGCCGG - Intronic
1007261212 6:40564651-40564673 GTGGAAAACTGATTGGAGGATGG - Intronic
1007384900 6:41513887-41513909 GTGGAGGACAGCCTAGAGGAAGG - Intergenic
1007440934 6:41859409-41859431 GTGGAAGATTTCTTGGAGGAAGG - Intronic
1007901732 6:45420021-45420043 GTGGAGCAGTGCATGGAGGAAGG + Intronic
1010162207 6:72869764-72869786 GTGGGGAATATCCTGAAGGAAGG - Intronic
1010455659 6:76051459-76051481 GTTGAGAACTACCTGTAGGAGGG - Intronic
1011323031 6:86117910-86117932 GATGAGATCTTACTGGAGGAGGG + Intergenic
1015705247 6:136080857-136080879 ATGGAGAGCTGCATGGAGGAAGG + Intronic
1016086154 6:139917952-139917974 GAGCATAACTTCATGGAGGAGGG - Intergenic
1017437421 6:154429508-154429530 AGGGAGGACTTCCTGGAGGTAGG - Intronic
1018605171 6:165589666-165589688 AAGGAGGCCTTCCTGGAGGAAGG + Intronic
1018714815 6:166523959-166523981 GTGGAGCACGTCCTGTAAGATGG - Intronic
1019455417 7:1124309-1124331 GTGGGGATCTGGCTGGAGGAGGG + Intronic
1019508025 7:1403254-1403276 CAGGAGTTCTTCCTGGAGGAGGG + Intergenic
1020116482 7:5479342-5479364 GTGGGGAATGTTCTGGAGGAAGG + Intronic
1022274670 7:28843401-28843423 GTGGAGGGATTCCTGGAAGAGGG - Intergenic
1022600172 7:31750318-31750340 GTGGAGAAATTGTTGGAGGTGGG + Intergenic
1022789124 7:33669262-33669284 ATGGAGCATTTCCTGGAGAACGG - Intergenic
1023407805 7:39854551-39854573 AAGGAGAACTTCCTCGAGGCTGG - Intergenic
1023576788 7:41636505-41636527 GTGGAGAGCTTTCTGCATGAAGG + Intergenic
1024730568 7:52249405-52249427 GTGCAGAGCTTCCTCCAGGAAGG - Intergenic
1025779160 7:64584354-64584376 GTGGTGAAATTCCTGGGGGGTGG - Intergenic
1025988064 7:66473520-66473542 ATAGAGAATTTCATGGAGGATGG + Intergenic
1026343578 7:69454732-69454754 ATGGAGTGCTTCCTGCAGGATGG - Intergenic
1026828730 7:73599256-73599278 GTGGAAGGCTTCCTGGAGAAGGG - Intronic
1027211049 7:76149417-76149439 ATAGAGAATTTCATGGAGGATGG + Intergenic
1028049037 7:86159257-86159279 GTGCAGAACTGGATGGAGGATGG + Intergenic
1028757326 7:94452682-94452704 GAAGAGAAGTTCCTGGGGGAGGG - Intergenic
1029279966 7:99429193-99429215 GTGGATGATTTCCTGGGGGAGGG + Exonic
1030023813 7:105302007-105302029 AAGGAGAACTTCCTCGAGGCTGG + Intronic
1030781501 7:113606182-113606204 ATGGAGAAATTCCTGGAGGGAGG + Intergenic
1033556010 7:142488971-142488993 GGGGAGTGCTTCCTGCAGGAGGG - Intergenic
1034272512 7:149810123-149810145 ATGGAGGGCTTCCTGAAGGAGGG + Intergenic
1034870962 7:154683564-154683586 ATGGAGAACATTCTGGAGTAGGG - Intronic
1035714626 8:1744450-1744472 GAGGGGGACTTCCTGGAGGAAGG + Intergenic
1035939026 8:3875412-3875434 TTGGAGGAGTTCCTGCAGGAGGG + Intronic
1036145431 8:6250599-6250621 GTGCAGAATCTCCTGGAGGGAGG + Intergenic
1036465289 8:8991764-8991786 GGGGGGAAAATCCTGGAGGAAGG + Intergenic
1036726435 8:11224879-11224901 TTGGAGAACATTATGGAGGAAGG - Intergenic
1037367383 8:18137205-18137227 CTGGAGGACATCTTGGAGGATGG - Intergenic
1037698665 8:21251436-21251458 GTGGAAAAATTACAGGAGGAAGG + Intergenic
1037909783 8:22737493-22737515 GCGGGGAATTTCCTGGAGGGCGG - Intronic
1038330481 8:26604426-26604448 CTGGAAGGCTTCCTGGAGGAGGG + Intronic
1039073394 8:33666600-33666622 GTGGAGAATGTCCTGGAAGTAGG - Intergenic
1039766354 8:40632505-40632527 GGTGAGATCATCCTGGAGGAGGG + Intronic
1041810032 8:61897570-61897592 CAGAAGGACTTCCTGGAGGAAGG - Intergenic
1043402632 8:79899080-79899102 GTGATGAAATTCCTGCAGGAAGG - Intergenic
1043915602 8:85919320-85919342 GTGTAGAAATTCCTGGGGTAGGG - Intergenic
1045372251 8:101535977-101535999 CTGGAAAATTTTCTGGAGGATGG + Intronic
1045388901 8:101695612-101695634 ATGGAAGGCTTCCTGGAGGAGGG - Intronic
1047792586 8:128219756-128219778 GTGGATAATTGCCTAGAGGAGGG + Intergenic
1047974189 8:130113059-130113081 GTGGAGAATGGACTGGAGGAAGG - Intronic
1050801017 9:9614989-9615011 GGGGAGAAATTGCAGGAGGAAGG + Intronic
1051533005 9:18126383-18126405 AAGGAGGACTTCCGGGAGGAGGG - Intergenic
1051936234 9:22446697-22446719 GTGGGGACCTTCTGGGAGGAGGG - Intergenic
1053103515 9:35391013-35391035 GTGGCCCACTTCCTGGAGAATGG + Intronic
1053142733 9:35691137-35691159 GTGGAGAGCCGCCGGGAGGAGGG + Intergenic
1053414273 9:37937026-37937048 TTGGAAGTCTTCCTGGAGGAGGG - Intronic
1053789768 9:41678658-41678680 AAGGAGTACTTCCTGGAAGAGGG - Intergenic
1054155373 9:61636095-61636117 AAGGAGTACTTCCTGGAAGAGGG + Intergenic
1054178108 9:61890348-61890370 AAGGAGTACTTCCTGGAAGAGGG - Intergenic
1054475159 9:65567206-65567228 AAGGAGTACTTCCTGGAAGAGGG + Intergenic
1054659421 9:67690476-67690498 AAGGAGTACTTCCTGGAAGAGGG + Intergenic
1056236435 9:84599218-84599240 TTGGATAACTTCCTGGGAGAAGG - Intergenic
1056246216 9:84697670-84697692 GTGGAGATCCTCCTGGAGGCAGG + Intronic
1056518498 9:87377794-87377816 GTTGACAACTTTCTGGAGAAAGG - Intergenic
1056719089 9:89058214-89058236 GTGGAGGACATGGTGGAGGATGG + Intronic
1056719113 9:89058315-89058337 GTGGAGGACATGGTGGAGGACGG + Intronic
1056719332 9:89059285-89059307 GTGGAGGACATGGTGGAGGACGG + Intronic
1056719338 9:89059310-89059332 GTGGAGGACGTTGTGGAGGATGG + Intronic
1056719414 9:89059633-89059655 GTGGAGGACGTGATGGAGGATGG + Intronic
1056719421 9:89059658-89059680 GTGGAGGACGTGGTGGAGGATGG + Intronic
1056719432 9:89059696-89059718 GTGGAGGACATGGTGGAGGATGG + Intronic
1056719442 9:89059734-89059756 GTGGAGGACGTGGTGGAGGATGG + Intronic
1056719456 9:89059785-89059807 GTGGAGGACGTTGTGGAGGATGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057329304 9:94097929-94097951 GCCGAGAACCTCCTGGAGCAAGG + Exonic
1057704328 9:97386814-97386836 AAGGACAACTTCCTGGAGGAGGG - Intergenic
1057809459 9:98246680-98246702 AGGGGAAACTTCCTGGAGGAGGG + Intronic
1057933936 9:99221325-99221347 GATGAAAACTTCCTGGAGGATGG + Intronic
1058662017 9:107275211-107275233 ATGGAGAATTCCCTAGAGGAAGG - Intergenic
1058812814 9:108657718-108657740 GAGGAGAACATTCTGGAAGATGG + Intergenic
1058955413 9:109942372-109942394 GTGAAGAATTTCATGGAGGCTGG - Intronic
1059003040 9:110370793-110370815 AAGGAGAACTCCCTGTAGGAAGG + Intronic
1059236972 9:112769384-112769406 GTGGACACTTTCCTGCAGGATGG - Intronic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1060183977 9:121552677-121552699 AGGGAGGACTTCCTGGAAGAAGG - Intergenic
1060217434 9:121746732-121746754 GGGAAGCACTTCCTGGAGAATGG + Intronic
1060781849 9:126418816-126418838 CTGGAAGGCTTCCTGGAGGAAGG - Intronic
1060934822 9:127508750-127508772 AAGGAGAGCTTCCTGGAGGAAGG + Intronic
1061046399 9:128167382-128167404 CAGGAGGGCTTCCTGGAGGAGGG - Intronic
1061564235 9:131426997-131427019 GAGGAGAATTTCCTTGAAGAAGG + Intronic
1061886268 9:133592487-133592509 GTGGGCACCTTCCTGGAAGAGGG - Intergenic
1062027156 9:134345914-134345936 AAGGAGGGCTTCCTGGAGGAGGG - Intronic
1062471905 9:136709850-136709872 GAGGAGGGCTTCCTGGGGGAGGG - Intergenic
1062629418 9:137457131-137457153 AAGGAGTGCTTCCTGGAGGAGGG - Intronic
1203745231 Un_GL000218v1:37673-37695 AGGGAAGACTTCCTGGAGGAGGG - Intergenic
1203458269 Un_GL000220v1:10883-10905 GATGACAACTTCCTAGAGGAAGG - Intergenic
1203564877 Un_KI270744v1:81811-81833 AGGGAAGACTTCCTGGAGGAGGG + Intergenic
1185653652 X:1667252-1667274 GAGGAGATCATCCTGGAGCAGGG - Intergenic
1185782082 X:2856615-2856637 GTGGAGAACTTACTGCTTGAAGG - Exonic
1186798226 X:13066993-13067015 GAGGGAAACTTCCTGGAGGAAGG + Intergenic
1186950376 X:14617886-14617908 GTCTGGAACTTCCTGGAAGAAGG + Intronic
1187293507 X:17977407-17977429 GAGGAAAACTTCATGGAAGAGGG - Intergenic
1187524621 X:20043101-20043123 GTGGAGCACTTTCTGCAGGCTGG - Intronic
1188114539 X:26226832-26226854 CTGGAGAAATTCCAGGAGAAAGG - Intergenic
1188472925 X:30560552-30560574 GTGGGAAACTTCCTGAAGGATGG - Intronic
1189211219 X:39285451-39285473 GTGGAGAGAGTCCTGGATGAAGG - Intergenic
1191846314 X:65550412-65550434 GTGGAGCACTACCAGGAGGAAGG + Intergenic
1192057123 X:67784505-67784527 GTGGAGGACTGGCTGGAGGAGGG - Intergenic
1192429252 X:71101437-71101459 GTGGCCAGCTTACTGGAGGAAGG - Exonic
1193083513 X:77427987-77428009 GTGGAGAACATCTGGGAAGATGG - Intergenic
1193144140 X:78059970-78059992 CTGGAGAAATACCTGGAGGGAGG - Intergenic
1197314976 X:124954569-124954591 GTGGAAAACTTCCTAGTTGATGG + Intronic
1197724519 X:129767776-129767798 GTGTGGACCCTCCTGGAGGAGGG - Intronic
1198936061 X:141903703-141903725 TTGGAGCACATCCTGGAGGTGGG + Intergenic
1199253778 X:145695339-145695361 AGGGAGAACATCCTGAAGGAGGG - Intergenic
1199926095 X:152465716-152465738 GTGGAGATCTTTCTGGAGACTGG - Intergenic
1200106832 X:153718876-153718898 GAGCAGATCCTCCTGGAGGATGG - Intronic
1201060017 Y:10036868-10036890 GTGGGAAAGTGCCTGGAGGAAGG + Intergenic