ID: 1088817577

View in Genome Browser
Species Human (GRCh38)
Location 11:113432205-113432227
Sequence TCAATCTGTTAGGACAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088817572_1088817577 5 Left 1088817572 11:113432177-113432199 CCAGGCTGATGGAGTGGGGTGAA 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1088817577 11:113432205-113432227 TCAATCTGTTAGGACAGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1088817570_1088817577 7 Left 1088817570 11:113432175-113432197 CCCCAGGCTGATGGAGTGGGGTG 0: 1
1: 0
2: 3
3: 26
4: 274
Right 1088817577 11:113432205-113432227 TCAATCTGTTAGGACAGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1088817571_1088817577 6 Left 1088817571 11:113432176-113432198 CCCAGGCTGATGGAGTGGGGTGA 0: 1
1: 0
2: 6
3: 60
4: 488
Right 1088817577 11:113432205-113432227 TCAATCTGTTAGGACAGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088817577 Original CRISPR TCAATCTGTTAGGACAGCCT GGG Intronic
901699721 1:11038718-11038740 TCAATCTCCAGGGACAGCCTTGG + Intronic
902087405 1:13874158-13874180 GCATTCTGTTACGGCAGCCTGGG - Intergenic
902930838 1:19730409-19730431 TGTATCAGTCAGGACAGCCTAGG - Intronic
904375378 1:30078245-30078267 TCAGTCTGTGAACACAGCCTTGG - Intergenic
904912683 1:33947212-33947234 GCAGTCTGTTAGGACAGCCCTGG - Intronic
905829130 1:41050166-41050188 CAACTCTGTTAGGACTGCCTCGG - Intronic
907361342 1:53918034-53918056 TCTATCAGTTAGGATAGGCTAGG + Intronic
912788029 1:112623373-112623395 ATAATCTGTTAAGACATCCTAGG + Intronic
919651286 1:200151226-200151248 TCAGTCTGTTAGGACATATTGGG + Intronic
920012569 1:202879936-202879958 TCAAACTGTTAGAGCAGCCCCGG + Exonic
922385426 1:225076284-225076306 TCAATCTGTGAGGACCAGCTTGG + Intronic
923260265 1:232261580-232261602 TGAAGCTGTTAGCACAGCCTGGG - Intergenic
923481038 1:234383814-234383836 TCAATCTTTATGAACAGCCTAGG - Exonic
1065317739 10:24480603-24480625 TCAGTGTGTTATGGCAGCCTGGG + Intronic
1069160336 10:65084540-65084562 TCCATCTGTGTGGAGAGCCTGGG - Intergenic
1073979919 10:109142834-109142856 TCAACCTGTGAGAGCAGCCTTGG + Intergenic
1074621138 10:115124260-115124282 TCAAACTTTTAGGACAGAGTAGG - Intronic
1078297901 11:10093489-10093511 TCAATTTCTTAAGACATCCTTGG + Intronic
1080518780 11:33048346-33048368 TCAATTTGTTAAGAGAACCTGGG - Intronic
1081394953 11:42575651-42575673 TCAAACAGCTAGGACATCCTGGG - Intergenic
1088817577 11:113432205-113432227 TCAATCTGTTAGGACAGCCTGGG + Intronic
1092491342 12:8948779-8948801 CCCATCTGTTAAGACAGCCATGG + Intronic
1092910702 12:13142590-13142612 TCAATCTTTAGGGACAGCCAAGG - Intergenic
1093518959 12:20025534-20025556 TCAAATTGTTAGTGCAGCCTGGG + Intergenic
1095727052 12:45465417-45465439 TGAAGGTGTGAGGACAGCCTGGG - Intergenic
1113317126 13:109192840-109192862 TTTATCTGTTATGACATCCTGGG + Intronic
1113428064 13:110226325-110226347 TTATTCTGTCAGGTCAGCCTGGG + Intronic
1119687762 14:76646117-76646139 TCAATCAGTCAGGATAGACTAGG - Intergenic
1131126734 15:89865040-89865062 TCCATCAGTCAGGACAGGCTTGG + Intronic
1138859299 16:60735989-60736011 TCACTCTGGGAGCACAGCCTAGG + Intergenic
1139444457 16:66988294-66988316 TGAAACTGTGAGGACAGCCAAGG + Intergenic
1141908030 16:87040540-87040562 TCAATCTGTCATGACACCCCAGG + Intergenic
1143866253 17:9926098-9926120 TCAAACTGCTGGGACACCCTGGG - Intronic
1147364393 17:39950975-39950997 TCAATCTGTGAGCAAAGCCCAGG + Intergenic
1148110644 17:45143288-45143310 TCAACCTGTCAGGACCACCTGGG + Intronic
1151510342 17:74555081-74555103 TCAACCTGTCAGCACAGCCAGGG + Intergenic
1151876967 17:76872312-76872334 TCAATCACTCAGGCCAGCCTTGG - Intronic
1152189037 17:78877024-78877046 TCAACCTGTTAGGACCTCCCAGG - Intronic
1153148963 18:2068158-2068180 TGACTCAGTTAAGACAGCCTGGG - Intergenic
1155822762 18:30398725-30398747 TCAATATGTTTGGACAACGTGGG - Intergenic
1156891617 18:42196848-42196870 TCAGTCTGTTATGAAAGCCCAGG + Intergenic
1161651259 19:5486790-5486812 TGTATCTGTTAGGATAGGCTTGG - Intergenic
1165139118 19:33688589-33688611 TCCATCAGTGAGGACAGCCCTGG + Intronic
1166147813 19:40849535-40849557 TCCATCTCTAAGGACATCCTGGG - Intronic
1166151948 19:40881306-40881328 TCCATCTCTGAGGACATCCTGGG - Intronic
1166178218 19:41089352-41089374 TCCATCTCTGAGGACATCCTGGG + Intronic
928469358 2:31558307-31558329 GCAATTTGTTATGGCAGCCTAGG - Intronic
930858462 2:56044290-56044312 GCAATCTGTAGGGGCAGCCTTGG + Intergenic
937017969 2:118623564-118623586 TTAATCTGTTATGGCAGCCCTGG - Intergenic
939543338 2:143520373-143520395 TTATACTGTAAGGACAGCCTTGG + Intronic
943889706 2:193271278-193271300 CCAACCTGTTAGAACAGCCATGG - Intergenic
943910976 2:193567170-193567192 TCAAGCTGTTTGGACAGTCATGG - Intergenic
944606865 2:201359687-201359709 TCTCTCTGTTATGCCAGCCTCGG + Intergenic
948098924 2:235358425-235358447 GCGATTTGTTAGGGCAGCCTAGG - Intergenic
948287880 2:236801071-236801093 TGCATCTGTGAGGACAGCCAGGG - Intergenic
1169624614 20:7550350-7550372 TCAATATGTGGGAACAGCCTAGG + Intergenic
1175441551 20:58995849-58995871 TCCATCTCTCAGGCCAGCCTTGG + Intronic
1176705133 21:10110900-10110922 TCAATTTGTTGTGATAGCCTAGG + Intergenic
1179556993 21:42185449-42185471 TCAGTATCTTAGGACAGCCAGGG + Intergenic
1181432319 22:22888886-22888908 TCGATCTGTGAGACCAGCCTGGG - Intronic
1182624169 22:31633963-31633985 CCACTCTGTTAGGACTCCCTTGG + Intronic
1185031671 22:48446837-48446859 TCCATCGGGTAGGACAGCATGGG - Intergenic
949267995 3:2183077-2183099 TCAGTCTTTTAGGAAATCCTTGG + Intronic
951429753 3:22592792-22592814 GTAATCTGTTACAACAGCCTTGG - Intergenic
955264499 3:57428251-57428273 GCAATTTGTTATGACAGCCCTGG + Intronic
962135477 3:132727290-132727312 TCTGTCTGTTAGGACAGGCTGGG - Intergenic
963934688 3:151040051-151040073 TCATTCTGTTAGGAGAGCACTGG + Intergenic
964492188 3:157248933-157248955 TCAATCTGTTTGGACTTCCTGGG + Intergenic
969414077 4:7047556-7047578 TCATTCAGTTAGCACAGCCTCGG + Intronic
970751487 4:19368494-19368516 GCAATTTGTTGGGACTGCCTGGG - Intergenic
972857432 4:43123651-43123673 TCAATGTGTCAGGAAAGCCATGG + Intergenic
976494557 4:85712452-85712474 ACAATCTGTTACAACAGCCAAGG - Intronic
979837942 4:125397118-125397140 TCAAGCTGTTAGGACAGATCTGG - Intronic
981635513 4:146874200-146874222 TCAATATGTTATAACAGCCAGGG - Intronic
983457947 4:167987262-167987284 ACAATCTGTGATCACAGCCTAGG - Intergenic
985139588 4:186825695-186825717 TAAATCTGGTAATACAGCCTAGG - Intergenic
989744716 5:44814952-44814974 TCCATCTGTGATCACAGCCTGGG - Exonic
992325301 5:75654470-75654492 ATAAACTGTTAGGGCAGCCTGGG + Intronic
992907207 5:81358242-81358264 TAAATCTCTTAGGACATCTTAGG - Intronic
993486920 5:88498171-88498193 TCAGTCTGGTAGGAAAGCTTAGG - Intergenic
996096670 5:119406603-119406625 TGAAACTGTTAGCACAGCCCTGG - Intergenic
1001383975 5:171323355-171323377 TCAATTTGTCAGCACAGCCACGG + Intergenic
1001753544 5:174149295-174149317 TCAATCTGGTAGCAAAGTCTAGG + Intronic
1004881327 6:20011273-20011295 TTAATCTGTTAGGATAGTCTGGG + Intergenic
1009463583 6:63943851-63943873 TATATCTGTTTGGTCAGCCTGGG - Intronic
1014885466 6:126775426-126775448 TACATCTATTAAGACAGCCTGGG - Intergenic
1016099207 6:140076610-140076632 ACAATCTGTTGATACAGCCTGGG - Intergenic
1017095456 6:150800721-150800743 ACACTCTGTTAGCACAGCCACGG - Exonic
1022176252 7:27874469-27874491 TAAATCTCTCAAGACAGCCTAGG + Intronic
1022974915 7:35548103-35548125 TCCATCAGTCAGGACAGGCTAGG - Intergenic
1024617256 7:51126422-51126444 TGCTTCTGTTAGGACAGGCTGGG + Intronic
1034957342 7:155343336-155343358 TCCATCTGTTAGGACCGCAGTGG - Intergenic
1037998501 8:23370308-23370330 TCAATCTGATAGGAGGACCTAGG - Intronic
1038348540 8:26755314-26755336 TCACTCTGTCAGGAAAGCCTTGG + Intronic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1041864003 8:62547742-62547764 TCAAGCTGTGAGGAGAGCCTGGG + Intronic
1045012151 8:97967709-97967731 ACAACCTGTGAGGGCAGCCTTGG - Intronic
1050338799 9:4615345-4615367 TCAATCTGCTAGGCCAGCAATGG - Intronic
1051054741 9:12971451-12971473 TCAATCTGGGAGGACAGGATGGG - Intergenic
1052290399 9:26833717-26833739 TAAATCTGTCAGGACATGCTTGG - Intergenic
1053642386 9:40097962-40097984 TCAATTTGTTGTGATAGCCTAGG + Intergenic
1053763752 9:41367503-41367525 TCAATTTGTTGTGATAGCCTAGG - Intergenic
1054323261 9:63695250-63695272 TCAATTTGTTGTGATAGCCTAGG + Intergenic
1054542367 9:66278682-66278704 TCAATTTGTTGTGATAGCCTAGG - Intergenic
1056920609 9:90785180-90785202 TCAGGCTGTTAACACAGCCTTGG + Intergenic
1059896987 9:118877269-118877291 TCAAGCTGTTAGAACAGACTGGG - Intergenic
1060024336 9:120158126-120158148 TGTATCAGTCAGGACAGCCTAGG - Intergenic
1202790165 9_KI270719v1_random:80999-81021 TCAATTTGTTGTGATAGCCTAGG + Intergenic
1187480738 X:19652883-19652905 TAAATCTGAAAGCACAGCCTTGG - Intronic
1194507700 X:94752996-94753018 ACAATCTGTTATGAAATCCTTGG - Intergenic
1195433024 X:104810683-104810705 TGTATCAGTTAGGACAGGCTAGG - Intronic