ID: 1088819404

View in Genome Browser
Species Human (GRCh38)
Location 11:113444632-113444654
Sequence CACCATTTATAGATGGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088819404_1088819407 -9 Left 1088819404 11:113444632-113444654 CCATGGGCCATCTATAAATGGTG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1088819407 11:113444646-113444668 TAAATGGTGGCTGATGATGACGG 0: 1
1: 0
2: 3
3: 22
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088819404 Original CRISPR CACCATTTATAGATGGCCCA TGG (reversed) Intronic
902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG + Intronic
906901188 1:49837952-49837974 CACCATTTATAGTAACCCCAGGG + Intronic
919612045 1:199757641-199757663 CATCATTTCAAGATGGCACAAGG + Intergenic
923243219 1:232106018-232106040 CACTATTGATAGGGGGCCCACGG + Intergenic
1064151744 10:12871370-12871392 AAGCATTTATAGATGGCTCCTGG - Intergenic
1064417878 10:15166691-15166713 CAAAATTTAGAGATGCCCCATGG - Intronic
1066536079 10:36393685-36393707 CACAATTTAAAAATGGCCAAAGG + Intergenic
1083495189 11:63045866-63045888 CCCCATTTATAAATGGGCAAAGG + Intergenic
1085454231 11:76656708-76656730 CACCACTTAAAGCTGGCTCAAGG + Intergenic
1085496847 11:76978122-76978144 CACCATCAATGTATGGCCCATGG - Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1090213757 11:124942204-124942226 CACCAATACTAGAAGGCCCAAGG - Intergenic
1090414614 11:126532144-126532166 CACATTTTATAGATGAACCAAGG + Intronic
1091100171 11:132864586-132864608 TACAATTTATAGATGACCAATGG - Intronic
1093665074 12:21802840-21802862 CACCCTATCTACATGGCCCAGGG - Intronic
1095498867 12:42814696-42814718 CACCTTTTAAAAATGGCCCTAGG - Intergenic
1117084684 14:52187537-52187559 CATCCTTTACAGATGTCCCATGG - Intergenic
1120418630 14:84253503-84253525 CATCACTTATAGATGGCAGAGGG + Intergenic
1122355685 14:101121727-101121749 CACCATTTGTAGCTGGTCCGGGG + Intergenic
1124487067 15:30127673-30127695 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124542152 15:30596648-30596670 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124756458 15:32410650-32410672 CTCCGTTTACAGATGGGCCAAGG - Intergenic
1126147301 15:45487862-45487884 GAACATTTAGAGATGGCACAAGG - Intronic
1128590632 15:68893645-68893667 CACCCTTTGTAGTTGTCCCACGG + Intronic
1129061090 15:72860955-72860977 TACCTTTTATAAATGCCCCAGGG + Intergenic
1133999099 16:10768814-10768836 CTCCATCTATAGATGGTCCGAGG + Exonic
1141500757 16:84442734-84442756 CACCACCAACAGATGGCCCAAGG - Intronic
1142103049 16:88285722-88285744 CACCACTCAGAGAGGGCCCAGGG - Intergenic
1146782134 17:35683783-35683805 CCCCATTTCTGGGTGGCCCAAGG - Intronic
1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG + Intronic
1157044412 18:44082022-44082044 CACCATTTTCAGTTGTCCCACGG - Intergenic
1157682741 18:49619604-49619626 CACCACTCAGAGATGGCCCCAGG - Intergenic
1161076316 19:2287504-2287526 CACGATGTACAGATGGCCCAGGG - Intronic
1164630264 19:29757513-29757535 GACCACTTAGAGATGGCCCAGGG + Intergenic
932924043 2:75950293-75950315 CACCATTATGAGATGACCCAAGG - Intergenic
937113711 2:119387953-119387975 CACCATTTCTAGATGACTCATGG - Intergenic
937647693 2:124284302-124284324 AACCATTTCTAGATGGGTCAGGG + Intronic
937817965 2:126274689-126274711 TACACTTTATACATGGCCCATGG - Intergenic
941686628 2:168455246-168455268 AACCATGTATACATGGGCCATGG + Intergenic
946147068 2:217739053-217739075 AACCATTTATTGGTGGCCAATGG - Intronic
1174547860 20:51339454-51339476 CACTCTTTCTAGATGGCACAAGG + Intergenic
949941906 3:9161563-9161585 CAGCATTTATTGAGTGCCCAAGG - Intronic
950140161 3:10609748-10609770 CAGCATCTTTAGATGGCTCAGGG + Intronic
950407695 3:12815002-12815024 CAGCATTTATAGATACCCTATGG - Intronic
951059508 3:18188716-18188738 CACCATTCTGAGATGCCCCAGGG + Intronic
952691467 3:36211381-36211403 TGCCATTTATAGATCTCCCAGGG - Intergenic
952854283 3:37755080-37755102 TACCATTTATTGCTGTCCCAAGG + Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
973024595 4:45251500-45251522 CACCATTTCTAGATGGTGGATGG - Intergenic
974963825 4:68736002-68736024 CACCTTTTAAAGAAGTCCCAGGG + Intergenic
976078615 4:81328606-81328628 CCCCATTTAAAAATGGACCAAGG + Intergenic
978668205 4:111212037-111212059 CAGCATTTATGAATGGCACATGG + Intergenic
981819017 4:148864565-148864587 AACAATTGATAGATGGCTCATGG - Intergenic
984295956 4:177854771-177854793 CACCATTAATACATGGACAATGG - Intronic
993935852 5:94001458-94001480 CATCATTTGTAGTTGCCCCATGG + Intronic
994196064 5:96924273-96924295 CACCATTTATGGAGGGCCCCTGG - Intronic
994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG + Intergenic
995803111 5:116021181-116021203 TACAATTTATAAATTGCCCAAGG + Intronic
996230862 5:121061666-121061688 CACCATTCCTAGATGAACCAAGG + Intergenic
1001934696 5:175695778-175695800 CAGCATTTAAGGATGGGCCAGGG + Intergenic
1003145906 6:3510625-3510647 CACCATTCATAGAGTGCTCACGG + Intergenic
1004187061 6:13430075-13430097 CACCTTTTATAGCTGACCCTTGG - Intronic
1010381297 6:75228246-75228268 CACGATTTAAAAATGGGCCAAGG + Intergenic
1011991597 6:93526568-93526590 CACGATTTACATATAGCCCAAGG + Intergenic
1014471761 6:121824022-121824044 GACCATTGATAAATGACCCATGG + Intergenic
1015336649 6:132046786-132046808 AACCCTTTTTAGATAGCCCAGGG + Intergenic
1017188779 6:151629735-151629757 CACCATTTATTTATGCACCAGGG + Intergenic
1017903071 6:158734832-158734854 TACCATTTATTGAAAGCCCAAGG + Intronic
1026811039 7:73465236-73465258 CTCTATATATAGATGGCCAAAGG + Intronic
1028004850 7:85552175-85552197 CACCATTTAAAAGTGGCCAAAGG + Intergenic
1034455145 7:151166227-151166249 CACCATTCATGGAGGGTCCAGGG + Intronic
1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG + Intergenic
1036391277 8:8326467-8326489 CCACATTTATAGAAGGGCCAGGG + Intronic
1037456912 8:19072932-19072954 CATCCTTTATAGTTGGGCCAAGG - Intronic
1038162958 8:25057620-25057642 CTCCATTTAAAAATGGGCCAAGG - Intergenic
1039958924 8:42229709-42229731 CAGCATTTACAGATTGCACATGG + Intergenic
1041425316 8:57714151-57714173 CACCATTTATTGATGGGGAAAGG - Intergenic
1045911977 8:107420693-107420715 CAGCATTCATATATGGTCCATGG + Intronic
1046502175 8:115092864-115092886 CACCTTTTGTAGTTGGCCCACGG + Intergenic
1048182937 8:132213088-132213110 CACCATTGATAAATGATCCATGG - Intronic
1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG + Intronic
1052048239 9:23820014-23820036 CACCATTTATATATACCCAAAGG + Intronic
1055690003 9:78819777-78819799 CAGCATTTATAGATGCCTCAGGG + Intergenic
1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG + Intronic
1057269679 9:93643818-93643840 GGCCATTTACAGAGGGCCCACGG - Intronic
1187375873 X:18754133-18754155 TAACATTTGTAAATGGCCCAAGG - Intronic
1187578189 X:20580084-20580106 CACCATGTACAGATTGGCCAAGG - Intergenic
1194935970 X:99949420-99949442 CACCATGTATACATGTGCCATGG + Intergenic
1195377601 X:104243074-104243096 TACCATTTAGAGAAGTCCCAGGG - Intergenic